A Key Sociocultural Method of Camelback Leisure Driving

An embedded gene choice methodology utilizing knockoffs optimizing neural community

 

Background: Gene alternative refers to find a small subset of discriminant genes from the gene expression profiles. The best way to decide on genes that affect explicit phenotypic traits efficiently is an important evaluation work throughout the topic of biology. The neural neighborhood has increased changing into functionality when dealing with nonlinear data, and it’ll most likely seize choices robotically and flexibly. On this work, we propose an embedded gene alternative methodology using neural neighborhood.

 

The important genes could also be obtained by calculating the burden coefficient after the teaching is achieved. In an effort to treatment the problem of black subject of neural neighborhood and extra make the teaching outcomes interpretable in neural neighborhood, we use the idea of knockoffs to assemble the knockoff attribute genes of the distinctive attribute genes. This technique not solely make each attribute gene to compete with each other, however moreover make each attribute gene compete with its knockoff attribute gene. This methodology could assist to select the necessary factor genes that affect the decision-making of neural networks.

 

Outcomes: We use maize carotenoids, tocopherol methyltransferase, raffinose family oligosaccharides and human breast most cancers dataset to do verification and analysis.

 

Conclusions: The experiment outcomes show that the knockoffs optimizing neural neighborhood methodology has increased detection affect than the alternative current algorithms, and particularly for processing the nonlinear gene expression and phenotype data.

 

Fenretinide
A3412-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 113
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells.

Fenretinide
A3412-50	ApexBio	50 mg	EUR 152
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells.

Fenretinide
HY-15373	MedChemExpress	10mM/1mL	EUR 126

Fenretinide
GP8861-10MG	Glentham Life Sciences	10 mg	EUR 94

Fenretinide
GP8861-25MG	Glentham Life Sciences	25 mg	EUR 142

 

Single cell transcriptomes reveal expression patterns of chemoreceptor genes in olfactory sensory neurons of the Caribbean spiny lobster, Panulirus argus

 

 

Background: Crustaceans categorical quite a lot of programs of receptor genes of their antennules, which house olfactory sensory neurons (OSNs) and non-olfactory chemosensory neurons. Transcriptomics analysis reveal that candidate chemoreceptor proteins embrace variant Ionotropic Receptors (IRs) along with every co-receptor IRs and tuning IRs, Transient Receptor Potential (TRP) channels, Gustatory Receptors, epithelial sodium channels, and class A G-protein coupled receptors (GPCRs). The Caribbean spiny lobster, Panulirus argus, expresses in its antennules nearly 600 IRs, 17 TRP channels, 1 Gustatory Receptor, 7 epithelial sodium channels, 81 GPCRs, 6 G proteins, and dozens of enzymes in signaling pathways.

 

However, the exact combinatorial expression patterns of these proteins in single sensory neurons normally aren’t acknowledged for any crustacean, limiting our understanding of how their chemosensory strategies encode chemical prime quality.

 

Outcomes: The aim of this analysis was to utilize transcriptomics to elucidate expression patterns of chemorece

 

Recombinant Sterol Carrier Protein 2 (SCP2)
4-RPC835Ra01	Cloud-Clone	EUR 433.31 EUR 219.00 EUR 1349.92 EUR 516.64 EUR 933.28 EUR 353.00 EUR 3224.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P11915 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.2kDa Isoelectric Point: Inquire
Description: Recombinant Rat Sterol Carrier Protein 2 expressed in: E.coli

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx131373	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx131374	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx141739	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx038200-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx034040-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx034040-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx006772	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx026860-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx026860-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx320284	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
20-abx322258	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx237652-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx237653-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody
abx237654-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Human Sterol Carrier Protein 2 (SCP2) Protein
20-abx650203	Abbexa	EUR 578.00 EUR 258.00 EUR 1692.00 EUR 676.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Sterol Carrier Protein 2 (SCP2) Protein
20-abx650204	Abbexa	EUR 606.00 EUR 258.00 EUR 1831.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Sterol Carrier Protein 2 (SCP2) ELISA Kit
abx383064-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human)
4-PAC835Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat)
4-PAC835Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC
4-PAC835Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Biotinylated
4-PAC835Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Cy3
4-PAC835Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), FITC
4-PAC835Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), HRP
4-PAC835Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), PE
4-PAC835Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC
4-PAC835Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Biotinylated
4-PAC835Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Cy3
4-PAC835Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), FITC
4-PAC835Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), HRP
4-PAC835Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), PE
4-PAC835Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC-Cy7
4-PAC835Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC-Cy7
4-PAC835Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCP2 (Ala433~Leu547) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 Antibody
20-abx115858	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sterol carrier protein 2 Antibody
abx431575-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Anti-Sterol carrier protein 2 antibody
STJ71576	St John's Laboratory	100 µg	EUR 359

SCP2 sterol-binding domain containing 1 Protein
20-abx263414	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Rat Sterol carrier protein 2 ELISA kit
E02S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit
E02S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit
E02S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit
E03S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit
E03S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit
E03S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit
E04S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit
E04S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit
E04S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit
E01S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit
E01S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit
E01S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit
E06S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit
E06S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit
E06S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit
E07S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit
E07S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit
E07S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit
E08S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit
E08S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit
E08S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit
E09S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit
E09S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit
E09S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2D1 SCP2 sterol-binding domain containing 1 Human Recombinant Protein
PROTQ9UJQ7	BosterBio	Regular: 10ug	EUR 317
Description: SCP2D1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.SCP2D1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal Sterol carrier protein 2 Antibody (internal region)
APR10298G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Sterol carrier protein 2 (internal region). This antibody is tested and proven to work in the following applications:

Guinea pig Sterol carrier protein 2 ELISA kit
E05S0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit
E05S0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit
E05S0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2 Recombinant Protein (Human)
RP027781	ABM	100 ug	Ask for price

SCP2 Recombinant Protein (Human)
RP027784	ABM	100 ug	Ask for price

SCP2 Recombinant Protein (Rat)
RP227723	ABM	100 ug	Ask for price

SCP2 Recombinant Protein (Mouse)
RP170345	ABM	100 ug	Ask for price

Recombinant purified (>98%) Human FAS Ligand Protein (carrier free)
FASL15-R-2	Alpha Diagnostics	2 ug	EUR 347

Scp2/ Rat Scp2 ELISA Kit
ELI-44038r	Lifescience Market	96 Tests	EUR 886

SCP2 siRNA
20-abx904812	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCP2 antibody
70R-3015	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SCP2 antibody raised against the middle region of SCP2

SCP2 Antibody
39403-100ul	SAB	100ul	EUR 390

SCP2 Antibody
43535-100ul	SAB	100ul	EUR 252

SCP2 siRNA
20-abx932653	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCP2 siRNA
20-abx932654	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCP2 Antibody
1-CSB-PA020856DA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCP2 Antibody
1-CSB-PA020856ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCP2 Antibody
1-CSB-PA020856ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SCP2 Antibody
1-CSB-PA020856GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-SCP2
YF-PA14533	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SCP2

anti-SCP2
YF-PA14534	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SCP2

Recombinant Human BD-2 Protein
PROTO15263-2	BosterBio	20ug	EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein
PROTP04090-2	BosterBio	25ug	EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Murine IL-2 Protein
PROTP04351-2	BosterBio	20ug	EUR 317
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues.

Recombinant Human PAI-2 Protein
PROTP05120-2	BosterBio	10ug	EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein
PROTP08253-2	BosterBio	10ug	EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

Mouse FGF-2 Recombinant Protein
R00121-2	BosterBio	5ug/vial	EUR 259
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Chicken IL-2 Recombinant Protein
R00387-2	BosterBio	5ug/vial	EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Recombinant Human TFF-2 Protein
PROTQ03403-2	BosterBio	20ug	EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer
PROTP12643-2	BosterBio	Regular: 20ug	EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

ErbB2 ErbB-2 Human Recombinant Protein
PROTP04626-2	BosterBio	Regular: 20ug	EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

IL-2 Interleukin-2 Human Recombinant Protein, His Tag
PROTP60568-2	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

SCP2 Conjugated Antibody
C43535	SAB	100ul	EUR 397

SCP2 cloning plasmid
CSB-CL020856HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 432 Sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggt Show more
Description: A cloning plasmid for the SCP2 gene.

SCP2 cloning plasmid
CSB-CL020856HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 969 Sequence: atgtcctcttccccgtgggagcctgcgaccctgcgccgggtgttcgtggtgggggttggcatgaccaagtttgtgaagcctggagctgagaattcaagagactaccctgacttggcagaagaagcaggcaagaaggctttagctgatgcacagatcccttattcagcagtggacca Show more
Description: A cloning plasmid for the SCP2 gene.

anti- SCP2 antibody
FNab07652	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: sterol carrier protein 2 Uniprot ID: P22307 Gene ID: 6342 Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody
FNab07653	FN Test	100µg	EUR 548.75
Immunogen: sterol carrier protein 2 Uniprot ID: P22307 Gene ID: 6342 Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody
FNab07654	FN Test	100µg	EUR 585
Immunogen: sterol carrier protein 2 Uniprot ID: P22307 Gene ID: 6342 Research Area: Metabolism
Description: Antibody raised against SCP2

SCP2 Rabbit pAb
A5382-100ul	Abclonal	100 ul	EUR 308

SCP2 Rabbit pAb
A5382-200ul	Abclonal	200 ul	EUR 459

SCP2 Rabbit pAb
A5382-20ul	Abclonal	20 ul	EUR 183

SCP2 Rabbit pAb
A5382-50ul	Abclonal	50 ul	EUR 223

SCP2 Polyclonal Antibody
A54392	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-SCP2 Antibody
A1414-100	Biovision		EUR 370

SCP2 Blocking Peptide
33R-6715	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCP2 antibody, catalog no. 70R-3015

Anti-SCP2 antibody
PAab07652	Lifescience Market	100 ug	EUR 386

Anti-SCP2 antibody
PAab07653	Lifescience Market	100 ug	EUR 386

Anti-SCP2 antibody
PAab07654	Lifescience Market	100 ug	EUR 412

Anti-SCP2 antibody
STJ27335	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.

Recombinant Human TGF-Beta 2 (insect derived) Protein
PROTP61812-2	BosterBio	10ug	EUR 317
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond. * Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

SCP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2104303	ABM	1.0 ug DNA	EUR 154

Scp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4797203	ABM	1.0 ug DNA	EUR 154

Scp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6784603	ABM	1.0 ug DNA	EUR 154

AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK
PROTP02765-2	BosterBio	Regular: 10ug	EUR 317
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein
PROTP09038-2	BosterBio	Regular: 50ug	EUR 317
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques.

TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein
PROTP16035-2	BosterBio	Regular: 20ug	EUR 317
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa.

Sterol O-Acyltransferase 2 (SOAT2) Antibody
20-abx321144	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody
20-abx321997	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody
abx238098-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
20-abx115859	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
20-abx003038	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
abx025838-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
abx025838-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
20-abx005230	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBP2) Antibody
20-abx218757	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody
20-abx334108	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody
abx238221-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody
20-abx241423	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody
20-abx242399	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein
PROTP20333-2	BosterBio	Regular: 20ug	EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO
PROTP49763-2	BosterBio	Regular: 25ug	EUR 317
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques.

B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag
PROTP61769-2	BosterBio	Regular: 5ug	EUR 317
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

LCN2 Neutrophil Gelatinase Associated Lipocalin/Lipocalin-2 Human Recombinant Protein
PROTP80188-2	BosterBio	Regular: 10ug	EUR 317
Description: LCN2 Human Recombinant produced in E.Coli is a homodimeric non-glycosylated polypeptide chains consisting of two 178 amino acids and having a molecular mass of 41.0kDa.

Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB
SREBP23-C	Alpha Diagnostics	100 ul	EUR 286

Rat SCP2 shRNA Plasmid
20-abx985105	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCP2 ELISA KIT|Human
EF002763	Lifescience Market	96 Tests	EUR 689

Human SCP2 shRNA Plasmid
20-abx954277	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SCP2 shRNA Plasmid
20-abx972590	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCP2 Antibody, HRP conjugated
1-CSB-PA020856DB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCP2 Antibody, FITC conjugated
1-CSB-PA020856DC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCP2 Antibody, Biotin conjugated
1-CSB-PA020856DD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SCP2 (2E9-1B3)
YF-MA15348	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SCP2

DCTN2 (1-403) Dynactin 2 (1-403 a.a.) Human Recombinant Protein
PROTQ13561-2	BosterBio	Regular: 20ug	EUR 317
Description: Dynactin 2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 426 amino acids (1-403 a.a) and having a molecular mass of 46.9kDa.;DCTN2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9
PROTQ99969-2	BosterBio	Regular: 5ug	EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Viral Nucleic Acid Extraction Kit I (300prep), (With Carrier RNA, for low viral load specimen using carrier RNA)
FAVNK-001-2	Favorgen	300 preps	EUR 397

Streptavidin Recombinant Protein
PROTP22629-2	BosterBio	Regular: 20mg	EUR 317
Description: Streptavidin Streptomyces Avidinii Recombinant produced in E.Coli. ;The molecular weight per tetramer is approximately 52kDa.

Recombinant Oxoglutarate Carrier Protein, Mitochondrial (OGC)
4-RPE461Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q02978 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.8kDa Isoelectric Point: 9.9
Description: Recombinant Human Oxoglutarate Carrier Protein, Mitochondrial expressed in: E.coli

Recombinant Acyl Carrier Protein, Mitochondrial (ACP)
4-RPA361Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O14561 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.7kDa Isoelectric Point: 6.7
Description: Recombinant Human Acyl Carrier Protein, Mitochondrial expressed in: E.coli

Recombinant Acyl Carrier Protein, Mitochondrial (ACP)
4-RPA361Mu01	Cloud-Clone	EUR 526.50 EUR 244.00 EUR 1699.36 EUR 633.12 EUR 1166.24 EUR 415.00 EUR 4098.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9CR21 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.9kDa Isoelectric Point: 7.8
Description: Recombinant Mouse Acyl Carrier Protein, Mitochondrial expressed in: E.coli

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (HRP)
20-abx337817	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (FITC)
20-abx337818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (Biotin)
20-abx337819	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

a.a.), TRAIL/APO 2 Ligand (114-281 a.a.) Human Recombinant Protein, Active
PROTP50591-2	BosterBio	Regular: 10ug	EUR 317
Description: Soluble TNF-related apoptosis-inducing ligand Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 169 amino acids _x000D_ (114-281) and having a molecular mass of 19.6 kDa._x000D_ The sTRAIL is purified by proprietary chromatographic techniques.

SLC3A2 Solute Carrier Family 3 Member 2 Human Recombinant Protein
PROTP08195	BosterBio	Regular: 10ug	EUR 317
Description: SLC3A2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 434 amino acids (206-630a.a.) and having a molecular mass of 47.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;SLC3A2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)
CG82-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)
CG82-1mg	Novoprotein	1mg	EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)
CG82-500ug	Novoprotein	500ug	EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)
CG82-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB，150mM NaCl,pH7.4.

Recombinant Solute Carrier Family 3, Member 2 (SLC3A2)
4-RPE348Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08195 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.5kDa Isoelectric Point: 7.1
Description: Recombinant Human Solute Carrier Family 3, Member 2 expressed in: E.coli

Recombinant Solute Carrier Family 3, Member 2 (SLC3A2)
4-RPE348Hu02	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08195 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Solute Carrier Family 3, Member 2 expressed in: E.coli

Recombinant Solute Carrier Family 3, Member 2 (SLC3A2)
4-RPE348Mu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P10852 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Solute Carrier Family 3, Member 2 expressed in: E.coli

Recombinant Solute Carrier Family 3, Member 2 (SLC3A2)
4-RPE348Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q794F9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.5kDa Isoelectric Point: 5.6
Description: Recombinant Rat Solute Carrier Family 3, Member 2 expressed in: E.coli

Recombinant Human Epiregulin Protein
PROTO14944-2	BosterBio	25ug	EUR 317
Description: Epiregulin is an EGF related growth factor that binds specifically to EGFR (ErbB1) and ErbB4, but not ErbB2 or ErbB3. It is expressed mainly in the placenta and peripheral blood leukocytes and in certain carcinomas of the bladder, lung, kidney and colon. Epiregulin stimulates the proliferation of keratinocytes, hepatocytes, fibroblasts and vascular smooth muscle cells. It also inhibits the growth of several tumor-derived epithelial cell lines. Human Epiregulin is initially synthesized as a glycosylated 19.0 kDa transmembrane precursor protein, which is processed by proteolytic cleavage to produce a 6.0 kDa mature secreted sequence. Recombinant human Epiregulin is a 5.6 kDa monomeric protein, containing 50 amino residues, which corresponds to the mature secreted Epiregulin sequence.

Recombinant Human LIGHT Protein
PROTO43557-2	BosterBio	15ug	EUR 317
Description: LIGHT belongs to the TNF family of ligands, and can signal through the herpes virus entry mediator type A receptor (HVEM, TNFRSF14), LTβR, or bind to a decoy receptor, DcR3. It is expressed in splenocytes, activated PBL, CD+8 tumor infiltrating lymphocytes, granulocytes, and monocytes. LIGHT has the ability to active NFκB, to co-stimulate the activation of lymphocytes and to induce apoptosis in certain human tumor cells. Recombinant human LIGHT has a calculated mass of 19.3 kDa containing 177 amino acid residues. Due to glycosylation LIGHT migrates between 20.0-22.5 kDa by SDS-PAGE under non-reducing conditions. *Human LIGHT(Catalog Number 310-09B) has replaced Human LIGHT(Catalog Number 310-09)

Recombinant Human Prolactin Protein
PROTP01236-2	BosterBio	50ug	EUR 317
Description: Prolactin is a neuroendocrine hormone secreted by the pituitary gland. Its primary function is to promote and maintain lactation during pregnancy and suckling. In addition, Prolactin plays an immune-regulatory role by stimulating the activities of ornithine decarboxylase and protein kinase C, which are important for the proliferation, differentiation, and function of lymphocytes. Recombinant human Prolactin is a 23 kDa globular protein containing 200 amino acid residues.

Glucagon Human Recombinant Protein
PROTP01275-2	BosterBio	Regular: 0.5mg	EUR 317
Description: Glucagon Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 29 amino acids and having a molecular mass of 3483 Dalton. ;The Glucagon is purified by proprietary chromatographic techniques.

Recombinant Human ApoE2 Protein
PROTP02649-2	BosterBio	500ug	EUR 317
Description: ApoE belongs to a group of proteins that bind reversibly with lipoprotein and play an important role in lipid metabolism. In addition to facilitating solublization of lipids, these proteins help to maintain the structural integrity of lipoproteins, serve as ligands for lipoprotein receptors, and regulate the activity of enzymes involved in lipid metabolism. Significant quantities of ApoE are produced in liver and brain and to some extent in almost every organ. ApoE is an important constituent of all plasma lipoproteins. It’s interaction with specific ApoE receptor enables uptake of chylomicron remnants by liver cells, which is an essential step during normal lipid metabolism. It also binds with the LDL receptor (apo B/E). Defects in ApoE are a cause of hyperlipoproteinemia type III. ApoE exists in three major isoforms; E2, E3, and E4, which differ from one another by a single amino-acid substitution. Compared with E3 and E4, E2 exhibits the lowest receptor binding affinity. E2 allele carriers had significantly lower levels of total cholesterol, low-density lipoprotein cholesterol, and non-high-density lipoprotein cholesterol, as well as increased ApoE levels. Recombinant human ApoE2 is a 34.3 kDa protein containing 300 amino acid residues.

Recombinant Human sCD23 Protein
PROTP06734-2	BosterBio	20ug	EUR 317
Description: CD23, the low affinity receptor for IgE, belongs to the C-type lectin structural family and plays a role in the regulation of IgE synthesis and IgE mediated activities. It is found both as a transmembrane receptor protein and in a soluble form, which is generated by proteolytic cleavage of membrane bound CD23. The predominant soluble form of CD23 (sCD23) consists of 172 amino acids corresponding to the extracellular domain of the full length precursor. sCD23, in addition to binding IgE, also exerts a number of IgE independent activities, such as promoting the activation and differentiation of B-cells and stimulating the release of pro-inflammatory cytokines from monocytes. Recombinant human sCD23 is a 19.2 kDa non-glycosylated protein containing 172 amino-acid residues.

Recombinant Rat EGF Protein
PROTP07522-2	BosterBio	100ug	EUR 317
Description: EGF is a potent growth factor that stimulates the proliferation of various epidermal and epithelial cells. Additionally, EGF has been shown to inhibit gastric secretion, and to be involved in wound healing. EGF signals through a receptor known as c-erbB, which is a class I tyrosine kinase receptor. This receptor also binds with TGF-α and VGF (vaccinia virus growth factor). Recombinant rat EGF is a 6.2 kDa globular protein containing 54 amino acid residues including 3 intramolecular disulfide-bonds.

CD14 Human Recombinant Protein
PROTP08571-2	BosterBio	Regular: 10ug	EUR 317
Description: CD14 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 353 amino acids (20-349 a.a) and having a molecular mass of 37.9kDa. ;CD14is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Vimentin Protein
PROTP08670-2	BosterBio	100ug	EUR 317
Description: Vimentin is a class III intermediate filament protein predominantly found in cells of mesenchymal origins, such as vascular endothelium and blood cells, where it functions as a major cytoskeletal component. Due to its importance and abundance in the cytoskeletal structure of mesenchymally-derived cells, Vimentin is frequently used as a developmental marker within cells of mesenchymal origin or cells undergoing epithelial-mesenchymal transition, which can occur during both normal and metastatic growth. An active participant within several critical processes of cellular organization and protein regulation, Vimentin is involved in the anchorage of organelles within the cytoplasmic matrix, development of astrocytes, and the disassembly of cellular components during the execution phase of apoptosis. Abnormalities in the normal physiological pathways of Vimentin have been implicated in deficient motility and directional migration involved in wound healing and cellular growth and development, as well as the adhesion-site accumulation of Vimentin on lens epithelial cells in cases of dominant cataracts. Recombinant Human Vimentin is a 54.5 kDa protein consisting of 472 amino acid residues, including a 6 residue C-terminal His-Tag.