ACTB Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ACTB Polyclonal Antibody

ABP57696-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

ABP57696-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

ABP57696-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ACTB protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein

ACTB Polyclonal Antibody

A52074 100 µg
EUR 570.55
Description: Ask the seller for details

Actb Polyclonal Antibody

A53186 100 µg
EUR 570.55
Description: The best epigenetics products

Human Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Hu-48T 48T
EUR 498
  • Should the Human Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Hu-96T 96T
EUR 647
  • Should the Human Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Mu-48T 48T
EUR 508
  • Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Mu-96T 96T
EUR 661
  • Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Ra-48T 48T
EUR 528
  • Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Actin Beta (ACTb) ELISA Kit

DLR-ACTb-Ra-96T 96T
EUR 690
  • Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Actin Beta (ACTb) ELISA Kit

RD-ACTb-Hu-48Tests 48 Tests
EUR 500

Human Actin Beta (ACTb) ELISA Kit

RD-ACTb-Hu-96Tests 96 Tests
EUR 692

Mouse Actin Beta (ACTb) ELISA Kit

RD-ACTb-Mu-48Tests 48 Tests
EUR 511

Mouse Actin Beta (ACTb) ELISA Kit

RD-ACTb-Mu-96Tests 96 Tests
EUR 709

Rat Actin Beta (ACTb) ELISA Kit

RD-ACTb-Ra-48Tests 48 Tests
EUR 534

Rat Actin Beta (ACTb) ELISA Kit

RD-ACTb-Ra-96Tests 96 Tests
EUR 742

Human Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Hu-48Tests 48 Tests
EUR 522

Human Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Hu-96Tests 96 Tests
EUR 724

Mouse Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Mu-48Tests 48 Tests
EUR 534

Mouse Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Mu-96Tests 96 Tests
EUR 742

Rat Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Ra-48Tests 48 Tests
EUR 558

Rat Actin Beta (ACTb) ELISA Kit

RDR-ACTb-Ra-96Tests 96 Tests
EUR 776

ACTB Rabbit pAb

AC006 50 ul
EUR 176

ACTB Rabbit mAb

AC026 50 ul
EUR 204

ACTB Rabbit mAb

AC038 50 ul
EUR 176

Polyclonal ACTB / Beta Actin Antibody

APR02611G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin . This antibody is tested and proven to work in the following applications:

ACTB Polyclonal Antibody, HRP Conjugated

A52075 100 µg
EUR 570.55
Description: The best epigenetics products

ACTB Polyclonal Antibody, FITC Conjugated

A52076 100 µg
EUR 570.55
Description: kits suitable for this type of research

ACTB Polyclonal Antibody, Biotin Conjugated

A52077 100 µg
EUR 570.55
Description: fast delivery possible

Actb Polyclonal Antibody, HRP Conjugated

A53187 100 µg
EUR 570.55
Description: kits suitable for this type of research

Actb Polyclonal Antibody, FITC Conjugated

A53188 100 µg
EUR 570.55
Description: fast delivery possible

Actb Polyclonal Antibody, Biotin Conjugated

A53189 100 µg
EUR 570.55
Description: reagents widely cited

Rabbit ACTb ELISA Kit

ERTA0406 96Tests
EUR 521

ACTB Antibody

35532-100ul 100ul
EUR 252

ACTB antibody

10R-10271 100 ug
EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody

10R-10272 100 ug
EUR 435
Description: Mouse monoclonal ACTB antibody

ACTB antibody

10R-1242 100 ug
EUR 512
Description: Mouse monoclonal ACTB antibody

ACTB antibody

70R-15285 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody

70R-15472 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody

ACTB antibody

70R-15561 50 ul
EUR 435
Description: Rabbit polyclonal ACTB antibody

ACTB Antibody

1-CSB-PA000350
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, X. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:3000IHC:1:200

ACTB Antibody

1-CSB-PA000813
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/1000-1/4000.IHC:1/100-1/300.ELISA:1/20000

ACTB Antibody

1-CSB-PA001207GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ACTB Antibody

1-CSB-PA001207NJ01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ACTB Antibody

CSB-PA551635-
EUR 335
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody

CSB-PA551635-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ACTB Antibody

1-CSB-PA244513
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:500-1:2000

ACTB Antibody

CSB-PA284599-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ACTB Antibody

CSB-PA284599-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Actb Antibody

1-CSB-PA07675A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ACTB Antibody

1-CSB-PA01629A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:100-1:500, IF:1:50-1:200

Rabbit Anti-Human ACTB monoclonal antibody

CABT-BL8441 100 ul
EUR 663

Rabbit Anti-Human ACTB monoclonal antibody

CABT-BL8442 100 ul
EUR 663

HRP-conjugated ACTB Rabbit mAb

AC028 50 ul
EUR 223

ACTB Conjugated Antibody

C35532 100ul
EUR 397

ACTB antibody (HRP)

60R-2233 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

ACTB antibody (FITC)

60R-2234 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (biotin)

60R-2235 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

ACTB antibody (biotin)

60R-1690 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (biotin)

ACTB antibody (FITC)

60R-1691 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (FITC)

ACTB antibody (HRP)

60R-1692 100 ug
EUR 327
Description: Rabbit polyclonal ACTB antibody (HRP)

Anti-ACTB Antibody

STJ500039 100 µg
EUR 515

Anti-ACTB Antibody

STJ500042 100 µg
EUR 476

Anti-ACTB antibody

STJ113532 100 µl
EUR 280
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB antibody

STJ116402 100 µl
EUR 277
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins.

Anti-ACTB antibody

STJ192006 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ACTB

Actb/ Rat Actb ELISA Kit

ELI-34919r 96 Tests
EUR 886

Polyclonal ACTB / Beta Actin Antibody (aa359-368)

APR02204G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (aa359-368). This antibody is tested and proven to work in the following applications:

Polyclonal ACTB / Beta Actin Antibody (C-Terminus)

APR02335G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ACTB / Beta Actin Antibody (N-Terminus)

APR02419G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ACTB / Beta Actin Antibody (N-Terminus)

APR02500G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ACTB / Beta Actin Antibody (C-Terminus)

APR02506G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ACTB / Beta Actin Antibody (aa2-16)

APR02825G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (aa2-16). This antibody is tested and proven to work in the following applications:

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse)

4-CAB340Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb)

Polyclonal Actin (ACTB/ACTC) Antibody (N-term)

APR04039G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Actin (ACTB/ACTC) (N-term). This antibody is tested and proven to work in the following applications:

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse)

4-PAB340Mi01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb)

Rabbit Anti-ACTB monoclonal antibody, clone KG64-21

DCABH-201802 100 ul
EUR 777

ACTB siRNA

20-abx900145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB siRNA

20-abx906619
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB siRNA

20-abx906620
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTB-1003

B2016-25
EUR 805

ACTB-1003

B2016-5
EUR 240

ACTB-1003

B4904-10 10 mg
EUR 601

ACTB-1003

B4904-100 100 mg
EUR 2364

ACTB-1003

B4904-5 5 mg
EUR 435

ACTB-1003

B4904-50 50 mg
EUR 1703

ACTB-1003

HY-16025 2mg
EUR 243

pOTB7-ACTB

PVT18471 2 ug
EUR 231

pET28a-ACTB

PVT14609 2 ug
EUR 495

Beta Actin (ACTB) Antibody

20-abx118009
  • EUR 551.00
  • EUR 481.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx129303
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx109486
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx109487
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx109488
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx110772
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159309
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159310
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159311
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159312
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159313-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159314
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

20-abx159315
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159316-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Actin Beta (ACTB) Antibody

abx159317-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx132139
  • EUR 328.00
  • EUR 84.00
  • EUR 746.00
  • EUR 439.00
  • EUR 112.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx132249
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Beta Actin (ACTB) Antibody

20-abx133823
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133824
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133825
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133826
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133827
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133829
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx133830
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx037900-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx037901-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx009628
  • EUR 258.00
  • EUR 356.00
  • EUR 175.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx010349-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx010457-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025152-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025189-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025190-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025190-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025616-400ul 400 ul
EUR 551
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx025616-80l 80 µl
EUR 321
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx005571
  • EUR 314.00
  • EUR 411.00
  • EUR 258.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx005572
  • EUR 314.00
  • EUR 411.00
  • EUR 258.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody

abx028417-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Actin (ACTB / ACTC) Antibody

abx028417-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018070-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018071-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx018342-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx019022-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx019023-100ug 100 ug
EUR 356
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx019024
  • EUR 321.00
  • EUR 119.00
  • 100 ug
  • 10 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx326896
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ACTB / POTEKP / ACTG1 Antibody

20-abx328332
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx330106
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx332202-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx332408-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx448540-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody

20-abx241125
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

abx230869-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody

abx230870-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody

abx230871-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody

abx230872-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody

abx230873-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Actin Beta (ACTB) Antibody

20-abx249494
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody

20-abx210097
  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ACTB/POTEKP/ACTG1 Antibody

1-CSB-PA000809
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTB/POTEKP/ACTG1. Recognizes ACTB/POTEKP/ACTG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Actb Antibody, HRP conjugated

1-CSB-PA07675B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Actb Antibody, FITC conjugated

1-CSB-PA07675C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Actb Antibody, Biotin conjugated

1-CSB-PA07675D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACTB Antibody, HRP conjugated

1-CSB-PA01629B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTB Antibody, FITC conjugated

1-CSB-PA01629C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTB Antibody, Biotin conjugated

1-CSB-PA01629D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ACTB Antibody (Biotin)

STJ500040 100 µg
EUR 586

Anti-ACTB Antibody (FITC)

STJ500041 100 µg
EUR 586

Anti-ACTB Antibody (Biotin)

STJ500043 100 µg
EUR 586

Anti-ACTB Antibody (FITC)

STJ500044 100 µg
EUR 586

Anti-ACTB mAb antibody

STJ11100960 100 µl
EUR 240
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. |Put 5ul AC026 into 45 ul buffer(with 50% glycerol), diluted 1:10,000 for using. The diluted antibody can be stored at -20‚ÑÉ without aliquot.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC

4-CAB340Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Biotinylated

4-CAB340Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Biotin.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Cy3

4-CAB340Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Cy3.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), FITC

4-CAB340Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with FITC.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), HRP

4-CAB340Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with HRP.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), PE

4-CAB340Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with PE.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC

4-PAB340Mi01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAB340Mi01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Biotin.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Cy3

4-PAB340Mi01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Cy3.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), FITC

4-PAB340Mi01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with FITC.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), HRP

4-PAB340Mi01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with HRP.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), PE

4-PAB340Mi01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with PE.

Rabbit Actin, cytoplasmic 1, ACTB ELISA KIT

ELI-24529Ra 96 Tests
EUR 928

Beta Actin (ACTB) Antibody Pair

abx117501-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (Biotin)

20-abx105088
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (Biotin)

20-abx105089
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (FITC)

20-abx106505
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (FITC)

20-abx106506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (HRP)

20-abx107922
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (HRP)

20-abx107923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta Actin (ACTB) Antibody (HRP)

20-abx017267
  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Actin Beta (ACTb) Antibody Pair

20-abx370254
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Beta Actin (ACTB) Antibody (ALP)

abx445183-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (APC)

abx445184-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (Biotin)

abx445185-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (FITC)

abx445186-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (HRP)

abx445187-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (PerCP)

abx445189-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (RPE)

abx445190-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (Streptavidin)

abx445191-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

F-Actin (ACTB/ACTG1) Antibody

abx414711-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

F-Actin (ACTB/ACTG1) Antibody

abx414712-50ug 50 ug
EUR 328
  • Shipped within 1 week.

Anti-beta Actin/ACTB Antibody

PA1872 100ug/vial
EUR 294

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-CAB340Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC-Cy7.

Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAB340Mi01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTb (Met1~Phe375)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC-Cy7.

ACTB Mouse mAb

AC004 50 ul
EUR 176

ACTB cloning plasmid

CSB-CL001207HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacg
  • Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid

CSB-CL001207HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
  • Show more
Description: A cloning plasmid for the ACTB gene.

ACTB cloning plasmid

CSB-CL001207HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
  • Show more
Description: A cloning plasmid for the ACTB gene.

SEAP (ActB, Puro)

LVP1221 1x107 IFU/ml x 200ul
EUR 349
Description: Lentivirus express SEAP under ActB promoter, containing puromycin selection.

pCMV-SPORT6-ACTB

PVT12614 2 ug
EUR 391

Actin Beta (ACTb) Monoclonal Antibody (Human)

4-CAB340Hu22
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Actin Beta (ACTb)

Beta Actin (ACTB) Antibody (ATTO 390)

abx445175-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 488)

abx445176-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 565)

abx445177-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 594)

abx445178-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 633)

abx445179-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 655)

abx445180-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 680)

abx445181-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Beta Actin (ACTB) Antibody (ATTO 700)

abx445182-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Actin Beta (ACTb) Monoclonal Antibody (Human)

4-MAB340Hu21
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Actin Beta (ACTb)

Rat ACTB shRNA Plasmid

20-abx986737
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ACTb ELISA Kit

EHA0406 96Tests
EUR 521

Goat ACTb ELISA Kit

EGTA0406 96Tests
EUR 521

Actin, cytoplasmic 1/ACTB

E21-E15 10ug
EUR 343

Canine ACTb ELISA Kit

ECA0406 96Tests
EUR 521

Chicken ACTb ELISA Kit

ECKA0406 96Tests
EUR 521

ACTB Rabbit Polyclonal Antibody