ADCY3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ADCY3 Polyclonal Antibody
ABP57715-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
  • Applications tips:
Description: A polyclonal antibody for detection of ADCY3 from Human. This ADCY3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
ADCY3 Polyclonal Antibody
ABP57715-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
  • Applications tips:
Description: A polyclonal antibody for detection of ADCY3 from Human. This ADCY3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
ADCY3 Polyclonal Antibody
ES10567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADCY3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ADCY3 Polyclonal Antibody
ES10567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADCY3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ADCY3 Rabbit pAb
A7870-100ul 100 ul
EUR 308
ADCY3 Rabbit pAb
A7870-200ul 200 ul
EUR 459
ADCY3 Rabbit pAb
A7870-20ul 20 ul
EUR 183
ADCY3 Rabbit pAb
A7870-50ul 50 ul
EUR 223
ADCY3 antibody
70R-14937 100 ul
EUR 392
Description: Rabbit polyclonal ADCY3 antibody
ADCY3 antibody
70R-15592 50 ul
EUR 435
Description: Rabbit polyclonal ADCY3 antibody
ADCY3 Antibody
36250-100ul 100ul
EUR 252
ADCY3 Antibody
1-CSB-PA001339GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
ADCY3 Antibody
1-CSB-PA106602
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
ADCY3 Antibody
DF2370 200ul
EUR 304
Description: ADCY3 antibody detects endogenous levels of total ADCY3.
ADCY3 Antibody
1-CSB-PA241921
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
ADCY3 Antibody
ABD2370 100 ug
EUR 438
Rabbit ADCY3 ELISA Kit
ERTA0495 96Tests
EUR 521
ADCY3 Conjugated Antibody
C36250 100ul
EUR 397
anti- ADCY3 antibody
FNab00156 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • IP: 1:200-1:2000
  • IF: 1:20-1:200
  • Immunogen: adenylate cyclase 3
  • Uniprot ID: O60266
  • Gene ID: 109
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against ADCY3
Anti-ADCY3 antibody
PAab00156 100 ug
EUR 355
Anti-ADCY3 antibody
STJ110180 100 µl
EUR 277
Description: This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene.
Anti-ADCY3 Antibody
STJ502055 100 µg
EUR 515
Anti-ADCY3 antibody
STJ191725 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ADCY3
Adcy3/ Rat Adcy3 ELISA Kit
ELI-49656r 96 Tests
EUR 886
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human)
4-PAB412Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3)
ADCY3 siRNA
20-abx900182
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADCY3 siRNA
20-abx906822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADCY3 siRNA
20-abx906823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-ADCY3 Antibody (Biotin)
STJ502066 100 µg
EUR 586
Anti-ADCY3 Antibody (FITC)
STJ502067 100 µg
EUR 586
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC
4-PAB412Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Biotinylated
4-PAB412Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Biotin.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Cy3
4-PAB412Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Cy3.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), FITC
4-PAB412Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with FITC.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), HRP
4-PAB412Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with HRP.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), PE
4-PAB412Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with PE.
Rabbit Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx362373-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ADCY3 Blocking Peptide
DF2370-BP 1mg
EUR 195
ADCY3 cloning plasmid
CSB-CL001339HU-10ug 10ug
EUR 1255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3435
  • Sequence: atgccgaggaaccagggcttctccgagcccgaatactcggccgagtactcagccgagtactccgtcagcctgccctccgaccctgaccgcggggtgggccggacccatgaaatctcggtccggaactcgggctcctgcctgtgcctgcctcgcttcatgcggctgactttcgtgc
  • Show more
Description: A cloning plasmid for the ADCY3 gene.
Recombinant Human ADCY3
P0521 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: O60266
Description: Recombinant Human protein for ADCY3
Adenylate Cyclase 3 (ADCY3) Antibody
20-abx007083
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
20-abx214544
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
20-abx214685
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
20-abx101937
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
20-abx110847
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
abx038409-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Adenylate Cyclase 3 (ADCY3) Antibody
abx230156-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC-Cy7
4-PAB412Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC-Cy7.
Human ADCY3 ELISA Kit
EHA0495 96Tests
EUR 521
Goat ADCY3 ELISA Kit
EGTA0495 96Tests
EUR 521
Canine ADCY3 ELISA Kit
ECA0495 96Tests
EUR 521
Anserini ADCY3 ELISA Kit
EAA0495 96Tests
EUR 521
Bovine ADCY3 ELISA Kit
EBA0495 96Tests
EUR 521
ADCY3 ELISA KIT|Human
EF007620 96 Tests
EUR 689
Rat ADCY3 shRNA Plasmid
20-abx986259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ADCY3 shRNA Plasmid
20-abx950072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADCY3 shRNA Plasmid
20-abx979619
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADCY3 ELISA Kit
EMA0495 96Tests
EUR 521
Rat ADCY3 ELISA Kit
ERA0495 96Tests
EUR 521
Porcine ADCY3 ELISA Kit
EPA0495 96Tests
EUR 521
Adenylate Cyclase III/ADCY3
RA22114 100 ul
EUR 435
Anti-ADCY3 (Adenylate Cyclase 3)
AR09-PA0001 100 ul
EUR 334
Description: Rabbit polyclonal to Rhe-b
Guinea Pig ADCY3 ELISA Kit
EGA0495 96Tests
EUR 521
Adcy3 ORF Vector (Rat) (pORF)
ORF063095 1.0 ug DNA
EUR 506
ADCY3 ORF Vector (Human) (pORF)
ORF012156 1.0 ug DNA
EUR 354
Adcy3 ORF Vector (Mouse) (pORF)
ORF038145 1.0 ug DNA
EUR 506
Adcy3 ORF Vector (Mouse) (pORF)
ORF038146 1.0 ug DNA
EUR 506
Adcy3 ORF Vector (Mouse) (pORF)
ORF038147 1.0 ug DNA
EUR 506
Recombinant Adenylate Cyclase 3 (ADCY3)
4-RPB412Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60266
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.9kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Adenylate Cyclase 3 expressed in: E.coli
ADCY3 ELISA Kit (Human) (OKEI00128)
OKEI00128 96 Wells
EUR 767
Description: Description of target: Catalyzes the formation of the signaling molecule cAMP in response to G-protein signaling. Participates in signaling cascades triggered by odorant receptors via its function in cAMP biosynthesis. Required for the perception of odorants. Required for normal sperm motility and normal male fertility. Plays a role in regulating insulin levels and body fat accumulation in response to a high fat diet.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL
Human Adenylate Cyclase 3 (ADCY3) Protein
20-abx065153
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Adcy3 sgRNA CRISPR Lentivector set (Rat)
K6969101 3 x 1.0 ug
EUR 339
ADCY3 sgRNA CRISPR Lentivector set (Human)
K0047601 3 x 1.0 ug
EUR 339
Adcy3 sgRNA CRISPR Lentivector set (Mouse)
K3866601 3 x 1.0 ug
EUR 339
Monkey Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx359569-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx361312-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx354307-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Chicken Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx356157-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Adenylate Cyclase 3 (ADCY3) ELISA Kit
abx364212-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6969102 1.0 ug DNA
EUR 154
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6969103 1.0 ug DNA
EUR 154
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6969104 1.0 ug DNA
EUR 154
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0047602 1.0 ug DNA
EUR 154
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0047603 1.0 ug DNA
EUR 154
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0047604 1.0 ug DNA
EUR 154
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3866602 1.0 ug DNA
EUR 154
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3866603 1.0 ug DNA
EUR 154
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3866604 1.0 ug DNA
EUR 154
ADCY3 Protein Vector (Mouse) (pPB-C-His)
PV152578 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPB-N-His)
PV152579 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-HA)
PV152580 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-His)
PV152581 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPB-C-His)
PV152582 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPB-N-His)
PV152583 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-HA)
PV152584 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-His)
PV152585 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPB-C-His)
PV152586 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPB-N-His)
PV152587 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-HA)
PV152588 500 ng
EUR 1065
ADCY3 Protein Vector (Mouse) (pPM-C-His)
PV152589 500 ng
EUR 1065
ADCY3 Protein Vector (Rat) (pPB-C-His)
PV252378 500 ng
EUR 1191
ADCY3 Protein Vector (Rat) (pPB-N-His)
PV252379 500 ng
EUR 1191
ADCY3 Protein Vector (Rat) (pPM-C-HA)
PV252380 500 ng
EUR 1191
ADCY3 Protein Vector (Rat) (pPM-C-His)
PV252381 500 ng
EUR 1191
ADCY3 Protein Vector (Human) (pPB-His-MBP)
PV320014 500 ng
EUR 481
ADCY3 Protein Vector (Human) (pPB-His-GST)
PV320015 500 ng
EUR 481
ADCY3 Protein Vector (Human) (pPB-C-His)
PV048621 500 ng
EUR 481
ADCY3 Protein Vector (Human) (pPB-N-His)
PV048622 500 ng
EUR 481
ADCY3 Protein Vector (Human) (pPM-C-HA)
PV048623 500 ng
EUR 481
ADCY3 Protein Vector (Human) (pPM-C-His)
PV048624 500 ng
EUR 481
Adcy3 3'UTR Luciferase Stable Cell Line
TU101425 1.0 ml Ask for price
Adcy3 3'UTR GFP Stable Cell Line
TU151425 1.0 ml Ask for price
Adcy3 3'UTR Luciferase Stable Cell Line
TU200306 1.0 ml Ask for price
Adcy3 3'UTR GFP Stable Cell Line
TU250306 1.0 ml Ask for price
ADCY3 3'UTR GFP Stable Cell Line
TU050356 1.0 ml
EUR 1394
ADCY3 3'UTR Luciferase Stable Cell Line
TU000356 1.0 ml
EUR 1394
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

ADCY3 Rabbit Polyclonal Antibody