ADCY3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ADCY3 Polyclonal Antibody |
ABP57715-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
- Applications tips:
|
Description: A polyclonal antibody for detection of ADCY3 from Human. This ADCY3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030 |
ADCY3 Polyclonal Antibody |
ABP57715-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030
- Applications tips:
|
Description: A polyclonal antibody for detection of ADCY3 from Human. This ADCY3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADCY3 protein at amino acid sequence of 950-1030 |
ADCY3 Polyclonal Antibody |
ES10567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ADCY3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ADCY3 Polyclonal Antibody |
ES10567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ADCY3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ADCY3 Rabbit pAb |
A7870-100ul |
Abclonal |
100 ul |
EUR 308 |
ADCY3 Rabbit pAb |
A7870-200ul |
Abclonal |
200 ul |
EUR 459 |
ADCY3 Rabbit pAb |
A7870-20ul |
Abclonal |
20 ul |
EUR 183 |
ADCY3 Rabbit pAb |
A7870-50ul |
Abclonal |
50 ul |
EUR 223 |
ADCY3 antibody |
70R-14937 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal ADCY3 antibody |
ADCY3 antibody |
70R-15592 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ADCY3 antibody |
ADCY3 Antibody |
36250-100ul |
SAB |
100ul |
EUR 252 |
ADCY3 Antibody |
1-CSB-PA001339GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
ADCY3 Antibody |
1-CSB-PA106602 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
ADCY3 Antibody |
DF2370 |
Affbiotech |
200ul |
EUR 304 |
Description: ADCY3 antibody detects endogenous levels of total ADCY3. |
ADCY3 Antibody |
1-CSB-PA241921 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200 |
Rabbit ADCY3 ELISA Kit |
ERTA0495 |
Abclonal |
96Tests |
EUR 521 |
ADCY3 Conjugated Antibody |
C36250 |
SAB |
100ul |
EUR 397 |
anti- ADCY3 antibody |
FNab00156 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- IP: 1:200-1:2000
- IF: 1:20-1:200
- Immunogen: adenylate cyclase 3
- Uniprot ID: O60266
- Gene ID: 109
- Research Area: Neuroscience, Signal Transduction, Metabolism
|
Description: Antibody raised against ADCY3 |
Anti-ADCY3 antibody |
STJ110180 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-ADCY3 antibody |
STJ191725 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ADCY3 |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human) |
4-PAB412Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3) |
ADCY3 siRNA |
20-abx900182 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADCY3 siRNA |
20-abx906822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADCY3 siRNA |
20-abx906823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC |
4-PAB412Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Biotinylated |
4-PAB412Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Biotin. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Cy3 |
4-PAB412Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Cy3. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), FITC |
4-PAB412Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with FITC. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), HRP |
4-PAB412Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with HRP. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), PE |
4-PAB412Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with PE. |
Rabbit Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx362373-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ADCY3 Blocking Peptide |
DF2370-BP |
Affbiotech |
1mg |
EUR 195 |
ADCY3 cloning plasmid |
CSB-CL001339HU-10ug |
Cusabio |
10ug |
EUR 1255 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3435
- Sequence: atgccgaggaaccagggcttctccgagcccgaatactcggccgagtactcagccgagtactccgtcagcctgccctccgaccctgaccgcggggtgggccggacccatgaaatctcggtccggaactcgggctcctgcctgtgcctgcctcgcttcatgcggctgactttcgtgc
- Show more
|
Description: A cloning plasmid for the ADCY3 gene. |
Recombinant Human ADCY3 |
P0521 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: O60266
|
Description: Recombinant Human protein for ADCY3 |
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx007083 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx214544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx214685 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx101937 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx110847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
abx038409-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
abx230156-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB412Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC-Cy7. |
Human ADCY3 ELISA Kit |
EHA0495 |
Abclonal |
96Tests |
EUR 521 |
Goat ADCY3 ELISA Kit |
EGTA0495 |
Abclonal |
96Tests |
EUR 521 |
Canine ADCY3 ELISA Kit |
ECA0495 |
Abclonal |
96Tests |
EUR 521 |
Anserini ADCY3 ELISA Kit |
EAA0495 |
Abclonal |
96Tests |
EUR 521 |
Bovine ADCY3 ELISA Kit |
EBA0495 |
Abclonal |
96Tests |
EUR 521 |
Rat ADCY3 shRNA Plasmid |
20-abx986259 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ADCY3 shRNA Plasmid |
20-abx950072 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADCY3 shRNA Plasmid |
20-abx979619 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADCY3 ELISA Kit |
EMA0495 |
Abclonal |
96Tests |
EUR 521 |
Rat ADCY3 ELISA Kit |
ERA0495 |
Abclonal |
96Tests |
EUR 521 |
Porcine ADCY3 ELISA Kit |
EPA0495 |
Abclonal |
96Tests |
EUR 521 |
Adenylate Cyclase III/ADCY3 |
RA22114 |
Neuromics |
100 ul |
EUR 435 |
Anti-ADCY3 (Adenylate Cyclase 3) |
AR09-PA0001 |
Abfrontier |
100 ul |
EUR 334 |
Description: Rabbit polyclonal to Rhe-b |
Guinea Pig ADCY3 ELISA Kit |
EGA0495 |
Abclonal |
96Tests |
EUR 521 |
Adcy3 ORF Vector (Rat) (pORF) |
ORF063095 |
ABM |
1.0 ug DNA |
EUR 506 |
ADCY3 ORF Vector (Human) (pORF) |
ORF012156 |
ABM |
1.0 ug DNA |
EUR 354 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038145 |
ABM |
1.0 ug DNA |
EUR 506 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038146 |
ABM |
1.0 ug DNA |
EUR 506 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038147 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Adenylate Cyclase 3 (ADCY3) |
4-RPB412Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O60266
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.9kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Human Adenylate Cyclase 3 expressed in: E.coli |
ADCY3 ELISA Kit (Human) (OKEI00128) |
OKEI00128 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Catalyzes the formation of the signaling molecule cAMP in response to G-protein signaling. Participates in signaling cascades triggered by odorant receptors via its function in cAMP biosynthesis. Required for the perception of odorants. Required for normal sperm motility and normal male fertility. Plays a role in regulating insulin levels and body fat accumulation in response to a high fat diet.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL |
Human Adenylate Cyclase 3 (ADCY3) Protein |
20-abx065153 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Adcy3 sgRNA CRISPR Lentivector set (Rat) |
K6969101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ADCY3 sgRNA CRISPR Lentivector set (Human) |
K0047601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Adcy3 sgRNA CRISPR Lentivector set (Mouse) |
K3866601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monkey Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx359569-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx361312-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx354307-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Chicken Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx356157-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx364212-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6969102 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6969103 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6969104 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0047602 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0047603 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0047604 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3866602 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3866603 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3866604 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152578 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152579 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152580 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152581 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152582 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152583 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152584 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152585 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152586 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152587 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152588 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152589 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Rat) (pPB-C-His) |
PV252378 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPB-N-His) |
PV252379 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPM-C-HA) |
PV252380 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPM-C-His) |
PV252381 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Human) (pPB-His-MBP) |
PV320014 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-His-GST) |
PV320015 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-C-His) |
PV048621 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-N-His) |
PV048622 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPM-C-HA) |
PV048623 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPM-C-His) |
PV048624 |
ABM |
500 ng |
EUR 481 |
Adcy3 3'UTR Luciferase Stable Cell Line |
TU101425 |
ABM |
1.0 ml |
Ask for price |
Adcy3 3'UTR GFP Stable Cell Line |
TU151425 |
ABM |
1.0 ml |
Ask for price |
Adcy3 3'UTR Luciferase Stable Cell Line |
TU200306 |
ABM |
1.0 ml |
Ask for price |
Adcy3 3'UTR GFP Stable Cell Line |
TU250306 |
ABM |
1.0 ml |
Ask for price |
ADCY3 3'UTR GFP Stable Cell Line |
TU050356 |
ABM |
1.0 ml |
EUR 1394 |
ADCY3 3'UTR Luciferase Stable Cell Line |
TU000356 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
ADCY3 Rabbit Polyclonal Antibody