AP1G1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

AP1G1 Polyclonal Antibody

ABP57782-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein

AP1G1 Polyclonal Antibody

ABP57782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein

AP1G1 Polyclonal Antibody

ABP57782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein

AP1G1 antibody

70R-3825 50 ug
EUR 467
Description: Rabbit polyclonal AP1G1 antibody raised against the C terminal of AP1G1

AP1G1 Antibody

36741-100ul 100ul
EUR 252

AP1G1 antibody

70R-15746 50 ul
EUR 435
Description: Rabbit polyclonal AP1G1 antibody

AP1G1 Antibody

1-CSB-PA001861GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AP1G1 Antibody

1-CSB-PA001861LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AP1G1 Antibody

1-CSB-PA248283
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

Polyclonal AP1G1 antibody - C-terminal region

APR14953G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AP1G1 - C-terminal region. This antibody is tested and proven to work in the following applications:

AP1G1 Conjugated Antibody

C36741 100ul
EUR 397

Anti-AP1G1 Antibody

A12998 100ug
EUR 432
Description: Goat Polyclonal AP1G1 Antibody. Validated in IP, WB and tested in Human.

Anti-AP1G1 antibody

STJ192028 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AP1G1

AP1G1 siRNA

20-abx907703
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP1G1 siRNA

20-abx907704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP1G1 Antibody, HRP conjugated

1-CSB-PA001861LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP1G1 Antibody, FITC conjugated

1-CSB-PA001861LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP1G1 Antibody, Biotin conjugated

1-CSB-PA001861LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal AP1G1 / Adaptin Gamma 1 Antibody (aa646-659)

APR14968G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AP1G1 / Adaptin Gamma 1 (aa646-659). This antibody is tested and proven to work in the following applications:

AP1G1 Blocking Peptide

33R-1979 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AP1G1 antibody, catalog no. 70R-3825

AP1G1 cloning plasmid

CSB-CL001861HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2478
  • Sequence: atgccagcccccatcagattgcgggagctgatccggaccatccggacagcccgaacccaagctgaagaacgagaaatgatccagaaagaatgtgctgcaatccggtcatcttttagagaagaagacaatacataccgatgtcggaatgtggcaaaattactgtatatgcacatgc
  • Show more
Description: A cloning plasmid for the AP1G1 gene.

Human AP1G1 shRNA Plasmid

20-abx950118
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AP1G1 shRNA Plasmid

20-abx969158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AP1G1 Recombinant Protein (Human)

RP001405 100 ug Ask for price

AP1G1 Recombinant Protein (Rat)

RP190406 100 ug Ask for price

AP1G1 Recombinant Protein (Mouse)

RP116213 100 ug Ask for price

AP1G1 ORF Vector (Human) (pORF)

ORF000469 1.0 ug DNA
EUR 95

Ap1g1 ORF Vector (Mouse) (pORF)

ORF038739 1.0 ug DNA
EUR 506

Ap1g1 ORF Vector (Rat) (pORF)

ORF063470 1.0 ug DNA
EUR 506

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

abx037674-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

abx038309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

20-abx318266
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AP1G1 sgRNA CRISPR Lentivector set (Human)

K0099601 3 x 1.0 ug
EUR 339

Ap1g1 sgRNA CRISPR Lentivector set (Mouse)

K4761501 3 x 1.0 ug
EUR 339

Ap1g1 sgRNA CRISPR Lentivector set (Rat)

K7122401 3 x 1.0 ug
EUR 339

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0099602 1.0 ug DNA
EUR 154

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0099603 1.0 ug DNA
EUR 154

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0099604 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4761502 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4761503 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4761504 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7122402 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7122403 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7122404 1.0 ug DNA
EUR 154

AP1G1 Protein Vector (Human) (pPB-C-His)

PV001873 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPB-N-His)

PV001874 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPM-C-HA)

PV001875 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPM-C-His)

PV001876 500 ng
EUR 329

AP1G1 Protein Vector (Mouse) (pPB-C-His)

PV154954 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPB-N-His)

PV154955 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPM-C-HA)

PV154956 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPM-C-His)

PV154957 500 ng
EUR 1065

AP1G1 Protein Vector (Human) (pPB-His-MBP)

PV322510 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPB-His-GST)

PV322511 500 ng
EUR 329

AP1G1 Protein Vector (Rat) (pPB-C-His)

PV253878 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPB-N-His)

PV253879 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPM-C-HA)

PV253880 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPM-C-His)

PV253881 500 ng
EUR 1166

Ap1g1 3'UTR Luciferase Stable Cell Line

TU200712 1.0 ml Ask for price

Ap1g1 3'UTR GFP Stable Cell Line

TU151902 1.0 ml Ask for price

AP1G1 3'UTR Luciferase Stable Cell Line

TU000902 1.0 ml
EUR 2333

Ap1g1 3'UTR Luciferase Stable Cell Line

TU101902 1.0 ml Ask for price

AP1G1 3'UTR GFP Stable Cell Line

TU050902 1.0 ml
EUR 2333

Ap1g1 3'UTR GFP Stable Cell Line

TU250712 1.0 ml Ask for price

Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody

20-abx110823
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody

20-abx212174
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AP1G1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626767 1.0 ug DNA
EUR 1355

AP1G1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626771 1.0 ug DNA
EUR 1355

AP1G1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626772 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody

ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody

ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody

ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody

ABP57581-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody

ABP57583-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody

ABP57585-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody

ABP57587-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody

ABP57587-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody

ABP57587-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody

ABP57588-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of FAK
  • Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody

ABP57588-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of FAK
  • Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody

ABP57588-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of FAK
  • Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody

ABP57589-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Gab1
  • Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody

ABP57589-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Gab1
  • Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody

ABP57589-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Gab1
  • Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody

ABP57590-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ERK1
  • Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody

ABP57590-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ERK1
  • Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody

ABP57590-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ERK1
  • Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

AP1G1 Rabbit Polyclonal Antibody