APOC2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

APOC2 Polyclonal Antibody

ES10844-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APOC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

APOC2 Polyclonal Antibody

ES10844-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APOC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Hu-48T 48T
EUR 498
  • Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Hu-96T 96T
EUR 647
  • Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Mu-48T 48T
EUR 508
  • Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Mu-96T 96T
EUR 661
  • Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Ra-48T 48T
EUR 528
  • Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

DLR-APOC2-Ra-96T 96T
EUR 690
  • Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Hu-48Tests 48 Tests
EUR 522

Human Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Hu-96Tests 96 Tests
EUR 724

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Mu-48Tests 48 Tests
EUR 534

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Mu-96Tests 96 Tests
EUR 742

Rat Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Ra-48Tests 48 Tests
EUR 558

Rat Apolipoprotein C2 (APOC2) ELISA Kit

RDR-APOC2-Ra-96Tests 96 Tests
EUR 776

Human Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Hu-48Tests 48 Tests
EUR 500

Human Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Hu-96Tests 96 Tests
EUR 692

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Mu-48Tests 48 Tests
EUR 511

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Mu-96Tests 96 Tests
EUR 709

Rat Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Ra-48Tests 48 Tests
EUR 534

Rat Apolipoprotein C2 (APOC2) ELISA Kit

RD-APOC2-Ra-96Tests 96 Tests
EUR 742

APOC2 Rabbit pAb

A1772-100ul 100 ul
EUR 308

APOC2 Rabbit pAb

A1772-200ul 200 ul
EUR 459

APOC2 Rabbit pAb

A1772-20ul 20 ul
EUR 183

APOC2 Rabbit pAb

A1772-50ul 50 ul
EUR 223

Rabbit APOC2 ELISA Kit

ERTA0522 96Tests
EUR 521

ApoC2 antibody

20C-CR9014GP 1 mg
EUR 165
Description: Goat polyclonal ApoC2 antibody (IgG fraction)

APOC2 antibody

38294-100ul 100ul
EUR 252

APOC2 Antibody

DF6607 200ul
EUR 304
Description: APOC2 Antibody detects endogenous levels of total APOC2.

APOC2 Antibody

ABD6607 100 ug
EUR 438

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse)

4-PAB996Eq01
  • EUR 271.00
  • EUR 2892.00
  • EUR 712.00
  • EUR 344.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2)

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse)

4-PAB996Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2)

ApoC2 Antibody (Center)

6718-100
EUR 316

APOC2 Conjugated Antibody

C38294 100ul
EUR 397

Anti-APOC2 antibody

STJ119761 100 µl
EUR 277
Description: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.

Anti-APOC2 antibody

STJ192002 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APOC2

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC

4-PAB996Eq01-APC
  • EUR 382.00
  • EUR 3797.00
  • EUR 1043.00
  • EUR 492.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Biotinylated

4-PAB996Eq01-Biotin
  • EUR 338.00
  • EUR 2842.00
  • EUR 823.00
  • EUR 419.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Cy3

4-PAB996Eq01-Cy3
  • EUR 468.00
  • EUR 5021.00
  • EUR 1349.00
  • EUR 614.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), FITC

4-PAB996Eq01-FITC
  • EUR 325.00
  • EUR 3057.00
  • EUR 854.00
  • EUR 413.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), HRP

4-PAB996Eq01-HRP
  • EUR 348.00
  • EUR 3307.00
  • EUR 920.00
  • EUR 443.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), PE

4-PAB996Eq01-PE
  • EUR 325.00
  • EUR 3057.00
  • EUR 854.00
  • EUR 413.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig)

4-PAB996Gu01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2)

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC

4-PAB996Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Biotinylated

4-PAB996Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Cy3

4-PAB996Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), FITC

4-PAB996Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), HRP

4-PAB996Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), PE

4-PAB996Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Rabbit Apolipoprotein C2 (APOC2) ELISA Kit

abx363339-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ApoC2 protein

30R-2678 50 ug
EUR 302
Description: Purified native Human ApoC2 protein

ApoC2 protein

30-1051 100 ug
EUR 1426
Description: Purified native Human ApoC2 protein

APOC2 siRNA

20-abx907836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOC2 siRNA

20-abx907837
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Apolipoprotein C2 (APOC2) Antibody

20-abx009580
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Apolipoprotein C2 (APOC2) Antibody

20-abx175434
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein C2 (APOC2) Antibody

20-abx175435
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein C2 (APOC2) Antibody

20-abx101715
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody

20-abx104940
  • EUR 467.00
  • EUR 133.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody

20-abx130650
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody

20-abx171276
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein C2 (APOC2) Antibody

20-abx171277
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC-Cy7

4-PAB996Eq01-APC-Cy7
  • EUR 644.00
  • EUR 7474.00
  • EUR 1966.00
  • EUR 864.00
  • EUR 349.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Thr23~Ser101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC

4-PAB996Gu01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Biotinylated

4-PAB996Gu01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Cy3

4-PAB996Gu01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), FITC

4-PAB996Gu01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), HRP

4-PAB996Gu01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), PE

4-PAB996Gu01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB996Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Ile13~Glu97)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

APOC2 Blocking Peptide

DF6607-BP 1mg
EUR 195

APOC2 cloning plasmid

CSB-CL001932HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccctcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta
  • Show more
Description: A cloning plasmid for the APOC2 gene.

APOC2 cloning plasmid

CSB-CL001932HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 219
  • Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccttcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta
  • Show more
Description: A cloning plasmid for the APOC2 gene.

Apolipoprotein C2 (APOC2) Antibody (Biotin)

20-abx272948
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC-Cy7

4-PAB996Gu01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOC2 (Asp32~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

Human APOC2 ELISA Kit

EHA0522 96Tests
EUR 521

Human APOC2 ELISA Kit

ELA-E1996h 96 Tests
EUR 824

Goat APOC2 ELISA Kit

EGTA0522 96Tests
EUR 521

Canine APOC2 ELISA Kit

ECA0522 96Tests
EUR 521

Chicken APOC2 ELISA Kit

ECKA0522 96Tests
EUR 521

Anserini APOC2 ELISA Kit

EAA0522 96Tests
EUR 521

Bovine APOC2 ELISA Kit

EBA0522 96Tests
EUR 521

APOC2 ELISA KIT|Human

EF000399 96 Tests
EUR 689

Mouse APOC2 shRNA Plasmid

20-abx969195
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human APOC2 shRNA Plasmid

20-abx950242
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse APOC2 ELISA Kit

EMA0522 96Tests
EUR 521

Rat APOC2 ELISA Kit

ERA0522 96Tests
EUR 521

Sheep APOC2 ELISA Kit

ESA0522 96Tests
EUR 521

Monkey APOC2 ELISA Kit

EMKA0522 96Tests
EUR 521

Porcine APOC2 ELISA Kit

EPA0522 96Tests
EUR 521

Recombinant Apolipoprotein C2 (APOC2)

4-RPB996Eq01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F7A1W7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 12.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Horse Apolipoprotein C2 expressed in: E.coli

Recombinant Apolipoprotein C2 (APOC2)

4-RPB996Gu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27916
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Guinea pig Apolipoprotein C2 expressed in: E.coli

Recombinant Apolipoprotein C2 (APOC2)

4-RPB996Mu01
  • EUR 449.44
  • EUR 223.00
  • EUR 1410.40
  • EUR 536.80
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q05020
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.4kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Apolipoprotein C2 expressed in: E.coli

APOC2 Recombinant Protein (Human)

RP001582 100 ug Ask for price

APOC2 Recombinant Protein (Human)

RP001585 100 ug Ask for price

APOC2 Recombinant Protein (Mouse)

RP116459 100 ug Ask for price

APOC2 Recombinant Protein (Rat)

RP190565 100 ug Ask for price

Human Apolipoprotein C-II (APOC2)

1-CSB-EP001932HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Apolipoprotein C-II(APOC2) expressed in E.coli

Human Apolipoprotein C-II (APOC2)

1-CSB-YP001932HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 10.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Apolipoprotein C-II(APOC2) expressed in Yeast

Horse Apolipoprotein C2 (APOC2) Protein

20-abx166394
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Apolipoprotein C2 (APOC2) Protein

20-abx065420
  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig APOC2 ELISA Kit

EGA0522 96Tests
EUR 521

ApoC2 receptor ELISA KIT|Human

EF007480 96 Tests
EUR 689

Rat Apolipoprotein C2 (APOC2) Protein

20-abx652550
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Apolipoprotein C2 (APOC2) Protein

20-abx652551
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apoc2 ORF Vector (Rat) (pORF)

ORF063523 1.0 ug DNA
EUR 506

APOC2 ORF Vector (Human) (pORF)

ORF000528 1.0 ug DNA
EUR 95

APOC2 ORF Vector (Human) (pORF)

ORF000529 1.0 ug DNA
EUR 95

Apoc2 ORF Vector (Mouse) (pORF)

ORF038821 1.0 ug DNA
EUR 506

APOC2 ELISA Kit (Human) (OKAN04534)

OKAN04534 96 Wells
EUR 792
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.74 ng/mL

APOC2 ELISA Kit (Mouse) (OKCA02336)

OKCA02336 96 Wells
EUR 846
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition Immunoassay;Sensitivity: 9.4 ng/mL

APOC2 ELISA Kit (Rat) (OKCD04474)

OKCD04474 96 Wells
EUR 857
Description: Description of target: cofactor and activator of lipoprotein lipase; crucial for the hydrolysis of triacylglycerols and very-low-density lipoproteins; mRNA found mainly in the liver [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.137 ng/mL

APOC2 ELISA Kit (Human) (OKCD07888)

OKCD07888 96 Wells
EUR 936
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.74ng/mL

APOC2 ELISA Kit (Rat) (OKCD09559)

OKCD09559 96 Wells
EUR 818
Description: Description of target: cofactor and activator of lipoprotein lipase; crucial for the hydrolysis of triacylglycerols and very-low-density lipoproteins; mRNA found mainly in the liver.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.69ng/mL

Apoc2 ELISA Kit (Mouse) (OKEH05270)

OKEH05270 96 Wells
EUR 662
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

APOC2 ELISA Kit (Monkey) (OKEI00626)

OKEI00626 96 Wells
EUR 741
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase. Both proapolipoprotein C-II and apolipoprotein C-II can activate lipoprotein lipase.;Species reactivity: Monkey;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.875 ng/mL

Human Apolipoprotein C2 (ApoC2) CLIA Kit

abx195165-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Apolipoprotein C2 (APOC2) ELISA Kit

20-abx150713
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

20-abx155220
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Guinea pig Apolipoprotein C2 (APOC2) Protein

20-abx168809
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

20-abx258738
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Apolipoprotein C2 (APOC2) ELISA Kit

abx253585-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Apolipoprotein C2 (APOC2) ELISA Kit

abx353379-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Apolipoprotein C2 (APOC2) ELISA Kit

abx356878-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Apolipoprotein C2 (APOC2) ELISA Kit

abx575242-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

abx575747-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Cow Apolipoprotein C2 (APOC2) ELISA Kit

abx519076-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Apolipoprotein C2 (APOC2) ELISA Kit

abx519077-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Apolipoprotein C2 (APOC2) ELISA Kit

abx519079-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Apolipoprotein C2 (APOC2) CLIA Kit

20-abx493349
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Apolipoprotein C2 (APOC2) CLIA Kit

20-abx493350
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Apolipoprotein C2 (APOC2) CLIA Kit

20-abx496329
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Apoc2 sgRNA CRISPR Lentivector set (Rat)

K7436701 3 x 1.0 ug
EUR 339

Apoc2 sgRNA CRISPR Lentivector set (Mouse)

K4843401 3 x 1.0 ug
EUR 339

APOC2 sgRNA CRISPR Lentivector set (Human)

K0106601 3 x 1.0 ug
EUR 339

Rat Apolipoprotein C2(APOC2)ELISA kit

QY-E10391 96T
EUR 361

Human Apolipoprotein C2 ELISA Kit (APOC2)

RK00922 96 Tests
EUR 521

Human Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit

4-SEB996Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein C2 elisa. Alternative names of the recognized antigen: APC2
  • Apo-C2
  • ProapoC-II
  • Apolipoprotein C-II
  • Proapolipoprotein C-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

SEB996Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit

4-SEB996Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein C2 elisa. Alternative names of the recognized antigen: APC2
  • Apo-C2
  • ProapoC-II
  • Apolipoprotein C-II
  • Proapolipoprotein C-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein C2 ELISA Kit (APOC2)

RK03507 96 Tests
EUR 521

Mouse Apolipoprotein C2(APOC2)ELISA kit

QY-E20150 96T
EUR 361

ELISA kit for Human ApoC2 (Apolipoprotein C2)

E-EL-H0466 1 plate of 96 wells
EUR 377
  • Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human ApoC2 (Apolipoprotein C2)

E-CL-H0379 1 plate of 96 wells
EUR 584
  • Gentaur's ApoC2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ApoC2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Monkey ApoC2 (Apolipoprotein C2)

E-EL-MK1665 1 plate of 96 wells
EUR 520
  • Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Monkey ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Monkey ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ApoC2 (Apolipoprotein C2)

E-EL-R1155 1 plate of 96 wells
EUR 534
  • Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant

Human APOC2/ Apolipoprotein C-II ELISA Kit

E0180Hu 1 Kit
EUR 537

Human APOC2(Apolipoprotein C-II) ELISA Kit

EH0619 96T
EUR 476.25
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P02655
  • Alias: ApoC2(Apolipoprotein C2)/Apolipoprotein C-II/APC2/APOC2/Apo-CII/ApoC-II/apolipoprotein C-II/MGC75082
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Bovine Apolipoprotein C- II, APOC2 ELISA KIT

ELI-06416b 96 Tests
EUR 928

Mouse Apolipoprotein C- II, Apoc2 ELISA KIT

ELI-06417m 96 Tests
EUR 865

Canine Apolipoprotein C-II, APOC2 ELISA KIT

ELI-06418d 96 Tests
EUR 928

Human Apolipoprotein C- II, APOC2 ELISA KIT

ELI-06419h 96 Tests
EUR 824

ELISA kit for Human APOC2 (Apolipoprotein C2)

ELK2740 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Apolipoprotein C2 (APOC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Apolipop
  • Show more
Description: A sandwich ELISA kit for detection of Apolipoprotein C2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Apolipoprotein C-II(APOC2) ELISA kit

CSB-EL001932MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Apolipoprotein C-II(APOC2) ELISA kit

1-CSB-EL001932MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Apolipoprotein C-II(APOC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat apolipoprotein C-II (APOC2) ELISA kit

CSB-EL001932RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat apolipoprotein C-II (APOC2) ELISA kit

1-CSB-EL001932RA
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Rat APOC2 (Apolipoprotein C2)

ELK6533 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Apolipoprotein C2 (APOC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Apolipop
  • Show more
Description: A sandwich ELISA kit for detection of Apolipoprotein C2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7436702 1.0 ug DNA
EUR 154

Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7436703 1.0 ug DNA
EUR 154

Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7436704 1.0 ug DNA
EUR 154

Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4843402 1.0 ug DNA
EUR 154

Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4843403 1.0 ug DNA
EUR 154

Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4843404 1.0 ug DNA
EUR 154

APOC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0106602 1.0 ug DNA
EUR 154

APOC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0106603 1.0 ug DNA
EUR 154

APOC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0106604 1.0 ug DNA
EUR 154

APOC2 Protein Vector (Mouse) (pPB-C-His)

PV155282 500 ng
EUR 603

APOC2 Protein Vector (Mouse) (pPB-N-His)

PV155283 500 ng
EUR 603

APOC2 Protein Vector (Mouse) (pPM-C-HA)

PV155284 500 ng
EUR 603

APOC2 Protein Vector (Mouse) (pPM-C-His)

PV155285 500 ng
EUR 603

APOC2 Protein Vector (Rat) (pPB-C-His)

PV254090 500 ng
EUR 603

APOC2 Protein Vector (Rat) (pPB-N-His)

PV254091 500 ng
EUR 603

APOC2 Protein Vector (Rat) (pPM-C-HA)

PV254092 500 ng
EUR 603

APOC2 Protein Vector (Rat) (pPM-C-His)

PV254093 500 ng
EUR 603

APOC2 Protein Vector (Human) (pPB-His-MBP)

PV322878 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-His-GST)

PV322879 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-His-MBP)

PV322882 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-His-GST)

PV322883 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-C-His)

PV002109 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-N-His)

PV002110 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPM-C-HA)

PV002111 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPM-C-His)

PV002112 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-C-His)

PV002113 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPB-N-His)

PV002114 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPM-C-HA)

PV002115 500 ng
EUR 329

APOC2 Protein Vector (Human) (pPM-C-His)

PV002116 500 ng
EUR 329

Apoc2 3'UTR GFP Stable Cell Line

TU151963 1.0 ml Ask for price

Apoc2 3'UTR Luciferase Stable Cell Line

TU101963 1.0 ml Ask for price

Apoc2 3'UTR Luciferase Stable Cell Line

TU200768 1.0 ml Ask for price

Apoc2 3'UTR GFP Stable Cell Line

TU250768 1.0 ml Ask for price

APOC2 3'UTR GFP Stable Cell Line

TU050971 1.0 ml
EUR 1394

APOC2 3'UTR Luciferase Stable Cell Line

TU000971 1.0 ml
EUR 1394

APOC2 ELISA Kit (Human) : 96 Wells (OKEH01418)

OKEH01418 96 Wells
EUR 635
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

APOC2 Rabbit Polyclonal Antibody