APOD Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
APOD Polyclonal Antibody |
ABP57794-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human APOD protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOD from Human, Mouse, Rat. This APOD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOD protein |
APOD Polyclonal Antibody |
A50041 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Human Apolipoprotein D (APOD) ELISA Kit |
DLR-APOD-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Apolipoprotein D (APOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein D (APOD) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
DLR-APOD-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Apolipoprotein D (APOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein D (APOD) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
RD-APOD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Apolipoprotein D (APOD) ELISA Kit |
RD-APOD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Apolipoprotein D (APOD) ELISA Kit |
RDR-APOD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Apolipoprotein D (APOD) ELISA Kit |
RDR-APOD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
APOD Rabbit pAb |
A5297-100ul |
Abclonal |
100 ul |
EUR 308 |
APOD Rabbit pAb |
A5297-200ul |
Abclonal |
200 ul |
EUR 459 |
APOD Rabbit pAb |
A5297-20ul |
Abclonal |
20 ul |
EUR 183 |
APOD Rabbit pAb |
A5297-50ul |
Abclonal |
50 ul |
EUR 223 |
APOD Rabbit pAb |
A15640-100ul |
Abclonal |
100 ul |
EUR 308 |
APOD Rabbit pAb |
A15640-200ul |
Abclonal |
200 ul |
EUR 459 |
APOD Rabbit pAb |
A15640-20ul |
Abclonal |
20 ul |
EUR 183 |
APOD Rabbit pAb |
A15640-50ul |
Abclonal |
50 ul |
EUR 223 |
APOD Rabbit pAb |
A16757-100ul |
Abclonal |
100 ul |
EUR 308 |
APOD Rabbit pAb |
A16757-200ul |
Abclonal |
200 ul |
EUR 459 |
APOD Rabbit pAb |
A16757-20ul |
Abclonal |
20 ul |
EUR 183 |
APOD Rabbit pAb |
A16757-50ul |
Abclonal |
50 ul |
EUR 223 |
APOD Rabbit pAb |
A16758-100ul |
Abclonal |
100 ul |
EUR 308 |
APOD Rabbit pAb |
A16758-200ul |
Abclonal |
200 ul |
EUR 459 |
APOD Rabbit pAb |
A16758-20ul |
Abclonal |
20 ul |
EUR 183 |
APOD Rabbit pAb |
A16758-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit APOD ELISA Kit |
ERTA0525 |
Abclonal |
96Tests |
EUR 521 |
APOD Polyclonal Antibody, HRP Conjugated |
A50042 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
APOD Polyclonal Antibody, FITC Conjugated |
A50043 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
APOD Polyclonal Antibody, Biotin Conjugated |
A50044 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ApoD antibody |
10R-A137b |
Fitzgerald |
100 ul |
EUR 597 |
Description: Mouse monoclonal ApoD antibody |
APOD Antibody |
32751-100ul |
SAB |
100ul |
EUR 252 |
ApoD antibody |
70R-13930 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Affinity purified Mouse polyclonal ApoD antibody |
APOD antibody |
70R-15776 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal APOD antibody |
APOD Antibody |
DF7987 |
Affbiotech |
200ul |
EUR 304 |
Description: APOD Antibody detects endogenous levels of total APOD. |
APOD Antibody |
1-CSB-PA001935EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
APOD Antibody |
1-CSB-PA001935GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse) |
4-PAB968Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD) |
Rabbit Apolipoprotein D (APOD) Protein |
20-abx652554 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
APOD Conjugated Antibody |
C32751 |
SAB |
100ul |
EUR 397 |
anti- APOD antibody |
FNab00499 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: apolipoprotein D
- Uniprot ID: P05090
- Gene ID: 347
- Research Area: Cancer, Immunology, Cardiovascular, Metabolism
|
Description: Antibody raised against APOD |
anti- APOD antibody |
FNab00500 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:5000-1:50000
- IF: 1:50-1:500
- Immunogen: apolipoprotein D
- Uniprot ID: P05090
- Gene ID: 347
- Research Area: Cancer, Immunology, Cardiovascular, Metabolism
|
Description: Antibody raised against APOD |
ApoD Antibody (NT) |
6719-100 |
Biovision |
|
EUR 316 |
Anti-APOD antibody |
STJ27250 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism. |
Anti-APOD antibody |
STJ192003 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to APOD |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse) |
4-PAB968Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD) |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), APC |
4-PAB968Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with APC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB968Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with Biotin. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), Cy3 |
4-PAB968Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with Cy3. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), FITC |
4-PAB968Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with FITC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), HRP |
4-PAB968Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with HRP. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), PE |
4-PAB968Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with PE. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat) |
4-PAB968Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2589.00
-
EUR 643.00
-
EUR 317.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD) |
Rabbit Apolipoprotein D(APOD) ELISA kit |
E04A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Apolipoprotein D(APOD) ELISA kit |
E04A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Apolipoprotein D(APOD) ELISA kit |
E04A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ApoD(Apolipoprotein D) ELISA Kit |
ERB0013 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 3.906-250 ng/ml
- Uniprot ID: P37153
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 2.344 ng/ml |
Rabbit Apolipoprotein D (APOD) ELISA Kit |
abx256978-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
APOD siRNA |
20-abx900377 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOD siRNA |
20-abx907842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOD siRNA |
20-abx907843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ApoD protein |
30R-2563 |
Fitzgerald |
10 ug |
EUR 458 |
Description: Purified recombinant Human ApoD protein |
Apolipoprotein D (APOD) Antibody |
20-abx126829 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx111027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx171280 |
Abbexa |
|
|
|
Apolipoprotein D (APOD) Antibody |
abx148249-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx101444 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 787.00
-
EUR 411.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx101445 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx101446 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1247.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein D (APOD) Antibody |
abx033389-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
abx033389-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx004047 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
abx432345-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Apolipoprotein D (APOD) Antibody |
abx432346-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Apolipoprotein D (APOD) Antibody |
20-abx301132 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody |
abx230499-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Apolipoprotein D (APOD) Antibody |
abx230500-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
APOD Antibody, HRP conjugated |
1-CSB-PA001935EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
APOD Antibody, FITC conjugated |
1-CSB-PA001935EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
APOD Antibody, Biotin conjugated |
1-CSB-PA001935ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-human apoD antibody |
STJ15100156 |
St John's Laboratory |
250 µg |
EUR 336 |
Description: This monoclonal antibody enables sensitive and specific detection of human apoD in immunoassays such as ELISA |
Anti-human apoD antibody |
STJ15100157 |
St John's Laboratory |
250 µg |
EUR 367 |
Description: This monoclonal antibody enables sensitive and specific detection of human apoD in immunoassays such as ELISA |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), APC |
4-PAB968Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with APC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB968Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with Biotin. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB968Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with Cy3. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB968Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with FITC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB968Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with HRP. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), PE |
4-PAB968Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with PE. |
Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB968Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Met1~Leu189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), APC |
4-PAB968Ra01-APC |
Cloud-Clone |
-
EUR 352.00
-
EUR 3383.00
-
EUR 939.00
-
EUR 450.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with APC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAB968Ra01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2539.00
-
EUR 747.00
-
EUR 388.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with Biotin. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAB968Ra01-Cy3 |
Cloud-Clone |
-
EUR 428.00
-
EUR 4469.00
-
EUR 1211.00
-
EUR 559.00
-
EUR 255.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with Cy3. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), FITC |
4-PAB968Ra01-FITC |
Cloud-Clone |
-
EUR 302.00
-
EUR 2726.00
-
EUR 771.00
-
EUR 380.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with FITC. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), HRP |
4-PAB968Ra01-HRP |
Cloud-Clone |
-
EUR 322.00
-
EUR 2948.00
-
EUR 830.00
-
EUR 407.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with HRP. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), PE |
4-PAB968Ra01-PE |
Cloud-Clone |
-
EUR 302.00
-
EUR 2726.00
-
EUR 771.00
-
EUR 380.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with PE. |
APOD Blocking Peptide |
DF7987-BP |
Affbiotech |
1mg |
EUR 195 |
APOD cloning plasmid |
CSB-CL001935HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 570
- Sequence: atggtgatgctgctgctgctgctttccgcactggctggcctcttcggtgcggcagagggacaagcatttcatcttgggaagtgccccaatcctccggtgcaggagaattttgacgtgaataagtatctcggaagatggtacgaaattgagaagatcccaacaacctttgagaatgg
- Show more
|
Description: A cloning plasmid for the APOD gene. |
Apolipoprotein D (APOD) Antibody (Biotin) |
20-abx274277 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein D (APOD) Antibody (HRP) |
20-abx303094 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody (FITC) |
20-abx303095 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Apolipoprotein D (APOD) Antibody (Biotin) |
20-abx303096 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Apolipoprotein D/APOD Antibody |
PA1388 |
BosterBio |
100ug/vial |
EUR 294 |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB968Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Ser189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7. |
Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAB968Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 585.00
-
EUR 6646.00
-
EUR 1759.00
-
EUR 781.00
-
EUR 326.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOD (Gln21~Leu189)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7. |
ApoD ELISA Kit| Rabbit Apolipoprotein D ELISA Kit |
EF016773 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat APOD shRNA Plasmid |
20-abx984857 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human APOD ELISA Kit |
EHA0525 |
Abclonal |
96Tests |
EUR 521 |
Goat APOD ELISA Kit |
EGTA0525 |
Abclonal |
96Tests |
EUR 521 |
Canine APOD ELISA Kit |
ECA0525 |
Abclonal |
96Tests |
EUR 521 |
Chicken APOD ELISA Kit |
ECKA0525 |
Abclonal |
96Tests |
EUR 521 |
Bovine APOD ELISA Kit |
EBA0525 |
Abclonal |
96Tests |
EUR 521 |
Anserini APOD ELISA Kit |
EAA0525 |
Abclonal |
96Tests |
EUR 521 |
Rat APOD ELISA Kit |
ERA0525 |
Abclonal |
96Tests |
EUR 521 |
Sheep APOD ELISA Kit |
ESA0525 |
Abclonal |
96Tests |
EUR 521 |
Porcine APOD ELISA Kit |
EPA0525 |
Abclonal |
96Tests |
EUR 521 |
Mouse APOD ELISA Kit |
EMA0525 |
Abclonal |
96Tests |
EUR 521 |
Monkey APOD ELISA Kit |
EMKA0525 |
Abclonal |
96Tests |
EUR 521 |
Human APOD shRNA Plasmid |
20-abx950245 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse APOD shRNA Plasmid |
20-abx969197 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
APOD Recombinant Protein (Human) |
RP001591 |
ABM |
100 ug |
Ask for price |
Recombinant Apolipoprotein D (APOD) |
4-RPB968Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P05090
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Apolipoprotein D expressed in: E.coli |
Recombinant Apolipoprotein D (APOD) |
4-RPB968Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P51910
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.5kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Mouse Apolipoprotein D expressed in: E.coli |
Recombinant Apolipoprotein D (APOD) |
4-RPB968Ra01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P23593
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Apolipoprotein D expressed in: E.coli |
APOD Recombinant Protein (Rat) |
RP190574 |
ABM |
100 ug |
Ask for price |
APOD Recombinant Protein (Mouse) |
RP116468 |
ABM |
100 ug |
Ask for price |
Guinea Pig APOD ELISA Kit |
EGA0525 |
Abclonal |
96Tests |
EUR 521 |
Human Apolipoprotein D (APOD) Protein |
20-abx065423 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Rat Apolipoprotein D (APOD) Protein |
20-abx065424 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein D (APOD) Protein |
20-abx065425 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
APOD ORF Vector (Human) (pORF) |
ORF000531 |
ABM |
1.0 ug DNA |
EUR 95 |
Apod ORF Vector (Mouse) (pORF) |
ORF038824 |
ABM |
1.0 ug DNA |
EUR 506 |
Apod ORF Vector (Rat) (pORF) |
ORF063526 |
ABM |
1.0 ug DNA |
EUR 506 |
APOD ELISA Kit (Human) (OKAN05227) |
OKAN05227 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.67 ng/mL |
APOD ELISA Kit (Mouse) (OKCA02337) |
OKCA02337 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.27 ng/mL |
APOD ELISA Kit (Human) (OKCD07852) |
OKCD07852 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Recombinant Human Apoliprotein-D;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.67ng/mL |
APOD ELISA Kit (Human) (OKEH04791) |
OKEH04791 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 ng/mL |
APOD ELISA Kit (Mouse) (OKEH05228) |
OKEH05228 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.3 pg/mL |
APOD ELISA Kit (Rat) (OKEH06044) |
OKEH06044 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.09 ng/mL |
APOD ELISA Kit (Chicken) (OKEI00104) |
OKEI00104 |
Aviva Systems Biology |
96 Wells |
EUR 741 |
Description: Description of target: ;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Cow Apolipoprotein D (APOD) ELISA Kit |
abx519620-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein D (APOD) ELISA Kit |
abx519622-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein D (APOD) ELISA Kit |
abx519623-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Apolipoprotein D (APOD) ELISA Kit |
abx361482-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein D (APOD) ELISA Kit |
abx573860-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Goat Apolipoprotein D(APOD) ELISA kit |
E06A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Apolipoprotein D(APOD) ELISA kit |
E06A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Apolipoprotein D(APOD) ELISA kit |
E06A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein D(APOD) ELISA kit |
E02A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein D(APOD) ELISA kit |
E02A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein D(APOD) ELISA kit |
E02A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apolipoprotein D(APOD) ELISA kit |
E03A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apolipoprotein D(APOD) ELISA kit |
E03A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apolipoprotein D(APOD) ELISA kit |
E03A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein D(APOD) ELISA kit |
E01A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein D(APOD) ELISA kit |
E01A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein D(APOD) ELISA kit |
E01A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Apolipoprotein D(APOD) ELISA kit |
E08A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Apolipoprotein D(APOD) ELISA kit |
E08A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Apolipoprotein D(APOD) ELISA kit |
E08A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Apolipoprotein D(APOD) ELISA kit |
E07A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Apolipoprotein D(APOD) ELISA kit |
E07A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Apolipoprotein D(APOD) ELISA kit |
E07A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Apolipoprotein D(APOD) ELISA kit |
E09A0518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Apolipoprotein D(APOD) ELISA kit |
E09A0518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Apolipoprotein D(APOD) ELISA kit |
E09A0518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human APOD(Apolipoprotein D) ELISA Kit |
EH2135 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: P05090
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
APOD sgRNA CRISPR Lentivector set (Human) |
K0106901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Apolipoprotein D (APOD) ELISA Kit |
20-abx150716 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Apolipoprotein D (ApoD) CLIA Kit |
abx195167-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Apolipoprotein D (APOD) ELISA Kit |
abx351120-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Monkey Apolipoprotein D (APOD) ELISA Kit |
abx359528-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein D (APOD) CLIA Kit |
20-abx493312 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Apolipoprotein D (APOD) ELISA Kit |
abx251470-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Apod sgRNA CRISPR Lentivector set (Mouse) |
K4337001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Apolipoprotein D(APOD) ELISA kit |
CSB-EL001935HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein D (APOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Apolipoprotein D(APOD) ELISA kit |
1-CSB-EL001935HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein D(APOD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Apolipoprotein D(APOD) ELISA kit |
CSB-EL001935MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Apolipoprotein D (APOD) in samples from serum, plasma, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Apolipoprotein D(APOD) ELISA kit |
1-CSB-EL001935MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Apolipoprotein D(APOD) in samples from serum, plasma, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human APOD/ Apolipoprotein D ELISA Kit |
E0183Hu |
Sunlong |
1 Kit |
EUR 571 |
Apod sgRNA CRISPR Lentivector set (Rat) |
K6867901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Apolipoprotrein D (ApoD) ELISA Kit |
MET-5074 |
Cell Biolabs |
96 assays |
EUR 722 |
Human Apolipoprotein D (APOD) ELISA Kit |
SEB968Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
SEB968Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
SEB968Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
SEB968Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids. |
Human Apolipoprotein D (APOD) ELISA Kit |
4-SEB968Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein D elisa. Alternative names of the recognized antigen: Apo-D
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein D (APOD) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Apolipoprotein D ELISA Kit (APOD) |
RK00925 |
Abclonal |
96 Tests |
EUR 521 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
APOD Rabbit Polyclonal Antibody