APOH Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
APOH Polyclonal Antibody |
ABP57795-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human APOH protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOH from Human, Mouse, Rat. This APOH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOH protein |
APOH Polyclonal Antibody |
ABP57795-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human APOH protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOH from Human, Mouse, Rat. This APOH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOH protein |
APOH Polyclonal Antibody |
ES10846-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against APOH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
APOH Polyclonal Antibody |
ES10846-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against APOH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Bovine Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-b-48T |
DL Develop |
48T |
EUR 547 |
- Should the Bovine Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Bovine Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-b-96T |
DL Develop |
96T |
EUR 715 |
- Should the Bovine Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein H (APOH) in samples from serum, plasma, saliva or other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein H (APOH) in samples from serum, plasma, saliva or other biological fluids. |
Rat Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids. |
Rat Apolipoprotein H (APOH) ELISA Kit |
DLR-APOH-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids. |
Bovine Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Bovine Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Human Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Apolipoprotein H (APOH) ELISA Kit |
RDR-APOH-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Bovine Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Bovine Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Human Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Apolipoprotein H (APOH) ELISA Kit |
RD-APOH-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
APOH Rabbit pAb |
A1220-100ul |
Abclonal |
100 ul |
EUR 308 |
APOH Rabbit pAb |
A1220-200ul |
Abclonal |
200 ul |
EUR 459 |
APOH Rabbit pAb |
A1220-20ul |
Abclonal |
20 ul |
EUR 183 |
APOH Rabbit pAb |
A1220-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit APOH ELISA Kit |
ERTA0528 |
Abclonal |
96Tests |
EUR 521 |
ApoH antibody |
20R-1405 |
Fitzgerald |
5 mg |
EUR 303 |
Description: Goat polyclonal ApoH antibody |
ApoH antibody |
70R-10595 |
Fitzgerald |
500 ug |
EUR 512 |
Description: Affinity purified goat polyclonal ApoH antibody |
ApoH antibody |
70R-3219 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ApoH antibody |
APOH antibody |
70R-15778 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal APOH antibody |
APOH Antibody |
32237-100ul |
SAB |
100ul |
EUR 252 |
APOH Antibody |
1-CSB-PA001939GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
APOH Antibody |
1-CSB-PA11079A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOH. Recognizes APOH from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
APOH Antibody |
1-CSB-PA795997 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50 |
APOH Antibody |
DF6352 |
Affbiotech |
200ul |
EUR 304 |
Description: APOH Antibody detects endogenous levels of total APOH. |
APOH Antibody |
1-CSB-PA297198 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
ApoH antibody |
70R-5421 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ApoH antibody |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine) |
4-PAA310Bo01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH) |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog) |
4-PAA310Ca01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH) |
Apolipoprotein H (APOH) Polyclonal Antibody (Human) |
4-PAA310Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH) |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse) |
4-PAA310Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH) |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat) |
4-PAA310Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH) |
ApoH antibody (HRP) |
60R-1043 |
Fitzgerald |
200 ug |
EUR 392 |
Description: Goat polyclonal ApoH antibody (HRP) conjugated |
ApoH Antibody Pair |
55R-1022 |
Fitzgerald |
5 plates |
EUR 719 |
Description: ApoH Matched Pair antibody Set for ELISA, B2GP1 ELISA kit, beta 2 glycoprotein ELISA kit, BG ELISA kit, Apolipoprotein H ELISA kit, Apo H ELISA kit, Apo-H ELISA kit, B2G1 ELISA kit |
APOH Conjugated Antibody |
C32237 |
SAB |
100ul |
EUR 397 |
Anti-APOH antibody |
STJ22654 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. |
Anti-APOH antibody |
STJ192004 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to APOH |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), APC |
4-PAA310Bo01-APC |
Cloud-Clone |
-
EUR 363.00
-
EUR 3527.00
-
EUR 975.00
-
EUR 465.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), Biotinylated |
4-PAA310Bo01-Biotin |
Cloud-Clone |
-
EUR 324.00
-
EUR 2644.00
-
EUR 773.00
-
EUR 399.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), Cy3 |
4-PAA310Bo01-Cy3 |
Cloud-Clone |
-
EUR 443.00
-
EUR 4661.00
-
EUR 1259.00
-
EUR 578.00
-
EUR 260.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), FITC |
4-PAA310Bo01-FITC |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), HRP |
4-PAA310Bo01-HRP |
Cloud-Clone |
-
EUR 331.00
-
EUR 3073.00
-
EUR 862.00
-
EUR 419.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), PE |
4-PAA310Bo01-PE |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with PE. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), APC |
4-PAA310Ca01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), Biotinylated |
4-PAA310Ca01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), Cy3 |
4-PAA310Ca01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), FITC |
4-PAA310Ca01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), HRP |
4-PAA310Ca01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), PE |
4-PAA310Ca01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with PE. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), APC |
4-PAA310Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), Biotinylated |
4-PAA310Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), Cy3 |
4-PAA310Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), FITC |
4-PAA310Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), HRP |
4-PAA310Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), PE |
4-PAA310Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with PE. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), APC |
4-PAA310Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA310Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), Cy3 |
4-PAA310Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), FITC |
4-PAA310Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), HRP |
4-PAA310Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), PE |
4-PAA310Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with PE. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), APC |
4-PAA310Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), Biotinylated |
4-PAA310Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), Cy3 |
4-PAA310Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), FITC |
4-PAA310Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), HRP |
4-PAA310Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), PE |
4-PAA310Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with PE. |
ApoH protein |
30-AB23 |
Fitzgerald |
1 mg |
EUR 1321 |
Description: Purified native Human ApoH protein |
APOH siRNA |
20-abx907848 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOH siRNA |
20-abx907849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOH Antibody, HRP conjugated |
1-CSB-PA11079B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
APOH Antibody, FITC conjugated |
1-CSB-PA11079C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
APOH Antibody, Biotin conjugated |
1-CSB-PA11079D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Apolipoprotein H (APOH) Antibody |
20-abx175442 |
Abbexa |
|
|
|
Apolipoprotein H (APOH) Antibody |
20-abx101452 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx101453 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx101454 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx104894 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx130240 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx132382 |
Abbexa |
-
EUR 356.00
-
EUR 913.00
-
EUR 467.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx171288 |
Abbexa |
-
EUR 314.00
-
EUR 787.00
-
EUR 411.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein H (APOH) Antibody |
20-abx171289 |
Abbexa |
|
|
|
Apolipoprotein H (APOH) Antibody |
20-abx225040 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein H (APOH) Antibody |
abx230509-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Apolipoprotein H (APOH) Antibody |
abx230510-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-human apoH antibody |
STJ15100149 |
St John's Laboratory |
250 µg |
EUR 336 |
Description: This monoclonal antibody enables sensitive and specific detection of apoH in immunoassays such as ELISA. |
Anti-human apoH antibody |
STJ15100150 |
St John's Laboratory |
250 µg |
EUR 367 |
Description: This monoclonal antibody enables sensitive and specific detection of apoH in immunoassays such as ELISA. |
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), APC-Cy7 |
4-PAA310Bo01-APC-Cy7 |
Cloud-Clone |
-
EUR 607.00
-
EUR 6934.00
-
EUR 1831.00
-
EUR 810.00
-
EUR 333.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), APC-Cy7 |
4-PAA310Ca01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Apolipoprotein H (APOH) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA310Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Thr22~Cys345)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA310Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Arg21~Cys345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA310Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOH (Gly20~Cys297)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Apolipoprotein H (APOH) Antibody (Biotin) |
20-abx271604 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1400.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein H (APOH) Antibody (Biotin) |
20-abx271969 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein H (APOH) Antibody (Biotin) |
20-abx272686 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1219.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein H (APOH) Antibody (FITC) |
20-abx273513 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1511.00
-
EUR 704.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein H (APOH) Antibody (FITC) |
20-abx273815 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein H (APOH) Antibody (FITC) |
20-abx274018 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ApoH Blocking Peptide |
33R-5558 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOH antibody, catalog no. 70R-5421 |
ApoH Blocking Peptide |
33R-7270 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOH antibody, catalog no. 70R-3219 |
APOH Blocking Peptide |
DF6352-BP |
Affbiotech |
1mg |
EUR 195 |
APOH cloning plasmid |
CSB-CL001939HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1038
- Sequence: atgatttctccagtgctcatcttgttctcgagttttctctgccatgttgctattgcaggacggacctgtcccaagccagatgatttaccattttccacagtggtcccgttaaaaacattctatgagccaggagaagagattacgtattcctgcaagccgggctatgtgtcccgag
- Show more
|
Description: A cloning plasmid for the APOH gene. |
Beta-2-Glycoprotein 1 (APOH) Antibody |
20-abx211114 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
20-abx211124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
20-abx111029 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
abx122365-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
20-abx338827 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
abx431884-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
abx432348-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody |
20-abx001132 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine) |
4-MAA310Bo21 |
Cloud-Clone |
-
EUR 267.00
-
EUR 2826.00
-
EUR 697.00
-
EUR 338.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH) |
ApoH protein (His tag) |
80R-2610 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant ApoH protein |
Human APOH ELISA Kit |
EHA0528 |
Abclonal |
96Tests |
EUR 521 |
Goat APOH ELISA Kit |
EGTA0528 |
Abclonal |
96Tests |
EUR 521 |
Canine APOH ELISA Kit |
ECA0528 |
Abclonal |
96Tests |
EUR 521 |
Chicken APOH ELISA Kit |
ECKA0528 |
Abclonal |
96Tests |
EUR 521 |
Anserini APOH ELISA Kit |
EAA0528 |
Abclonal |
96Tests |
EUR 521 |
Bovine APOH ELISA Kit |
EBA0528 |
Abclonal |
96Tests |
EUR 521 |
Mouse APOH shRNA Plasmid |
20-abx969199 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human APOH shRNA Plasmid |
20-abx950247 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse APOH ELISA Kit |
EMA0528 |
Abclonal |
96Tests |
EUR 521 |
Rat APOH ELISA Kit |
ERA0528 |
Abclonal |
96Tests |
EUR 521 |
Sheep APOH ELISA Kit |
ESA0528 |
Abclonal |
96Tests |
EUR 521 |
Monkey APOH ELISA Kit |
EMKA0528 |
Abclonal |
96Tests |
EUR 521 |
Porcine APOH ELISA Kit |
EPA0528 |
Abclonal |
96Tests |
EUR 521 |
Recombinant Apolipoprotein H (APOH) |
4-RPA310Bo01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P17690
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Bovine Apolipoprotein H expressed in: E.coli |
Recombinant Apolipoprotein H (APOH) |
4-RPA310Ca01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P33703
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Dog Apolipoprotein H expressed in: E.coli |
Recombinant Apolipoprotein H (APOH) |
4-RPA310Hu01 |
Cloud-Clone |
-
EUR 279.20
-
EUR 178.00
-
EUR 772.00
-
EUR 324.00
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02749
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Apolipoprotein H expressed in: E.coli |
Recombinant Apolipoprotein H (APOH) |
4-RPA310Mu01 |
Cloud-Clone |
-
EUR 386.72
-
EUR 206.00
-
EUR 1175.20
-
EUR 458.40
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q01339
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.1kDa
- Isoelectric Point: 8.5
|
Description: Recombinant Mouse Apolipoprotein H expressed in: E.coli |
Recombinant Apolipoprotein H (APOH) |
4-RPA310Ra01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P26644
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.0kDa
- Isoelectric Point: 8.7
|
Description: Recombinant Rat Apolipoprotein H expressed in: E.coli |
APOH Recombinant Protein (Human) |
RP001600 |
ABM |
100 ug |
Ask for price |
Recombinant Human ApoH Protein |
RP01089 |
Abclonal |
10 μg |
EUR 190 |
APOH Recombinant Protein (Mouse) |
RP116477 |
ABM |
100 ug |
Ask for price |
APOH Recombinant Protein (Rat) |
RP190583 |
ABM |
100 ug |
Ask for price |
Human APOH ELISA Kit |
STJ150241 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ApoH in human serum, plasma and other biological fluids |
Mouse APOH ELISA Kit |
STJ150423 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of APO-H in Mouse serum, plasma and other biological fluids |
Rabbit Apolipoprotein H (Beta-2-Glycoprotein 1) (APOH) ELISA Kit |
abx256254-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Apolipoprotein H (Beta-2-Glycoprotein 1) (APOH) ELISA Kit |
abx362900-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody (HRP) |
20-abx334818 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody (FITC) |
20-abx334819 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta-2-Glycoprotein 1 (APOH) Antibody (Biotin) |
20-abx334820 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), APC |
4-MAA310Bo21-APC |
Cloud-Clone |
-
EUR 376.00
-
EUR 3707.00
-
EUR 1020.00
-
EUR 483.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC. |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), Biotinylated |
4-MAA310Bo21-Biotin |
Cloud-Clone |
-
EUR 334.00
-
EUR 2776.00
-
EUR 806.00
-
EUR 412.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Biotin. |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), Cy3 |
4-MAA310Bo21-Cy3 |
Cloud-Clone |
-
EUR 459.00
-
EUR 4901.00
-
EUR 1319.00
-
EUR 602.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Cy3. |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), FITC |
4-MAA310Bo21-FITC |
Cloud-Clone |
-
EUR 320.00
-
EUR 2985.00
-
EUR 836.00
-
EUR 406.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with FITC. |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), HRP |
4-MAA310Bo21-HRP |
Cloud-Clone |
-
EUR 342.00
-
EUR 3229.00
-
EUR 901.00
-
EUR 435.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with HRP. |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), PE |
4-MAA310Bo21-PE |
Cloud-Clone |
-
EUR 320.00
-
EUR 2985.00
-
EUR 836.00
-
EUR 406.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with PE. |
Dog Apolipoprotein H (APOH) Protein |
20-abx166342 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Apolipoprotein H (APOH) Protein |
20-abx168482 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cow Apolipoprotein H (APOH) Protein |
20-abx065434 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Apolipoprotein H (APOH) Protein |
20-abx065435 |
Abbexa |
-
EUR 411.00
-
EUR 217.00
-
EUR 1052.00
-
EUR 467.00
-
EUR 300.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein H (APOH) Protein |
20-abx065436 |
Abbexa |
-
EUR 551.00
-
EUR 244.00
-
EUR 1595.00
-
EUR 648.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human APOH PicoKine ELISA Kit |
EK2026 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human APOH in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse APOH PicoKine ELISA Kit |
EK2027 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse APOH in cell culture supernates, serum and plasma (heparin, EDTA). |
Guinea Pig APOH ELISA Kit |
EGA0528 |
Abclonal |
96Tests |
EUR 521 |
Apoh ORF Vector (Rat) (pORF) |
ORF063529 |
ABM |
1.0 ug DNA |
EUR 506 |
APOH ORF Vector (Human) (pORF) |
ORF000534 |
ABM |
1.0 ug DNA |
EUR 95 |
Apoh ORF Vector (Mouse) (pORF) |
ORF038827 |
ABM |
1.0 ug DNA |
EUR 506 |
APOH Apoliporotein-H Bovine protein |
PROTP17690 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Bovine Apolipoprotein-H polypeptide is purified from fetal calf serum (FCS) by proprietary protein-chemical techniques, having an Mw of approximately 70kDa. |
APOH ELISA Kit (Mouse) (OKAN06620) |
OKAN06620 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.42 ng/mL |
Apoh ELISA Kit (Mouse) (OKBB01395) |
OKBB01395 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Apolipoprotein H (Apo-H), previously known as β2-glycoprotein I and beta-2 glycoprotein I, is a 38 kDa multifunctional apolipoprotein that in humans is encoded by the APOH gene. This gene is mapped to 11 E1; 11 71.8 Cm. Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
APOH ELISA Kit (Human) (OKCD06239) |
OKCD06239 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antipho;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.141ng/mL |
APOH ELISA Kit (Mouse) (OKCD06240) |
OKCD06240 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1.42ng/mL |
APOH ELISA Kit (Rat) (OKCD06241) |
OKCD06241 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.73ng/mL |
APOH ELISA Kit (Rat) (OKEH04191) |
OKEH04191 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.79 ng/mL |
APOH ELISA Kit (Mouse) (OKEH04192) |
OKEH04192 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.28 ng/mL |
APOH ELISA Kit (Bovine) (OKEH07365) |
OKEH07365 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.51ng/ml |
APOH ELISA Kit (Dog) (OKEH07366) |
OKEH07366 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.38ng/ml |
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), APC-Cy7 |
4-MAA310Bo21-APC-Cy7 |
Cloud-Clone |
-
EUR 632.00
-
EUR 7294.00
-
EUR 1921.00
-
EUR 846.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg21~Cys345
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7. |
Human Apolipoprotein H (ApoH) CLIA Kit |
abx196453-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein H(APOH) ELISA kit |
CSB-E08961h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Apolipoprotein H(APOH) ELISA kit |
1-CSB-E08961h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein H(APOH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Apolipoprotein H (APOH) CLIA Kit |
20-abx491366 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Apolipoprotein H (APOH) CLIA Kit |
20-abx491367 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Apolipoprotein H (APOH) CLIA Kit |
20-abx491368 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Canine Apolipoprotein H(APOH)ELISA Kit |
GA-E0031CN-48T |
GenAsia Biotech |
48T |
EUR 402 |
Canine Apolipoprotein H(APOH)ELISA Kit |
GA-E0031CN-96T |
GenAsia Biotech |
96T |
EUR 684 |
Apoh sgRNA CRISPR Lentivector set (Rat) |
K6740201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Apoh sgRNA CRISPR Lentivector set (Mouse) |
K3377501 |
ABM |
3 x 1.0 ug |
EUR 339 |
APOH sgRNA CRISPR Lentivector set (Human) |
K0107301 |
ABM |
3 x 1.0 ug |
EUR 339 |
APOH Apolipoprotein-H Human Recombinant Protein |
PROTP02749 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: APOH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 349 amino acids (20-345 a.a.) and having a molecular mass of 38.6kDa.;APOH is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Apolipoprotein H (APOH) ELISA Kit |
SEA310Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
SEA310Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
SEA310Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
SEA310Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Human Apolipoprotein H (APOH) ELISA Kit |
4-SEA310Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein H elisa. Alternative names of the recognized antigen: Apo-H
- B2G1
- BG
- B2-GP1
- B2GP1
- Previously
- Beta 2 Glycoprotein 1
- APC inhibitor
- Activated protein C-binding protein
- Anticardiolipin cofactor
- Beta(2)GPI
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein H (APOH) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
SEA310Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
SEA310Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
SEA310Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
SEA310Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids. |
Mouse Apolipoprotein H (APOH) ELISA Kit |
4-SEA310Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein H elisa. Alternative names of the recognized antigen: Apo-H
- B2G1
- BG
- B2-GP1
- B2GP1
- Previously
- Beta 2 Glycoprotein 1
- APC inhibitor
- Activated protein C-binding protein
- Anticardiolipin cofactor
- Beta(2)GPI
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Apolipoprotein H (APOH) in samples from Serum, plasma, saliva and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein H (APOH) ELISA Kit |
SEA310Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Rat Apolipoprotein H (APOH) ELISA Kit |
SEA310Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
Rat Apolipoprotein H (APOH) ELISA Kit |
SEA310Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids. |
APOH Rabbit Polyclonal Antibody