Axonal regeneration in the rat spinal cord produced by an antibody against myelin-associated neurite growth inhibitors.

Antibodies, Cultrex, Default, Dot, EIA, electrophoresis, Exosomes, Gels, Goat, HRP, Isotypes, NATtrol, Particles, Rabbit, Species, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ,

After lesions within the differentiated central nervous system (CNS) of upper vertebrates, interrupted fibre tracts don’t regrow and elongate by greater than an preliminary sprout of roughly 1 mm. Transplantations of items of peripheral nerves into numerous elements of the CNS display the widespread functionality of CNS neurons to regenerate lesioned axons over lengthy distances in a peripheral nerve setting. CNS white matter, cultured oligodendrocytes (the myelin-producing cells of the CNS), and CNS myelin itself, are sturdy inhibitors of neuron progress in tradition, a property related to outlined myelin membrane proteins of relative molecular mass (Mr) 35,000 (NI-35) and 250,000 (NI-250).

Now we have now intracerebrally utilized the monoclonal antibody IN-1, which neutralizes the inhibitory impact of each these proteins, to younger rats by implanting antibody-producing tumours. In 2-6-week-old rats we made full transections of the cortico-spinal tract, a serious fibre tract of the spinal twine, the axons of which originate within the motor and sensory neocortex. Earlier research have proven an entire absence of cortico-spinal tract regeneration after the primary postnatal week in rats, and in grownup hamsters and cats. In IN-1-treated rats, large sprouting occurred on the lesion website, and high-quality axons and fascicles may very well be noticed as much as 7-11 mm caudal to the lesion inside 2-Three weeks.

In management rats, an identical sprouting response occurred, however the maximal distance of elongation not often exceeded 1 mm. These outcomes display the capability for CNS axons to regenerate and elongate inside differentiated CNS tissue after the neutralization of myelin-associated neurite progress inhibitors. The cytological and topographical distribution of S-100 and glial fibrillary acidic (GFA) proteins within the grownup rat mind has been in contrast utilizing the horseradish peroxidase-labelled antibody method.

Each proteins are current in astrocytes and buildings composed of astrocytic processes, specifically the glial limitans and the perivascular membranes, however the cytological localization varies between the 2 proteins. S-100 is discovered within the nucleus and cytoplasm whereas GFA protein is confined to the cytoplasm. Neither is present in neurons, however S-100 is current in some oligodendroglia, suggesting a common regulatory position in glia. Though GFA protein in current in each protoplasmic and fibrous astrocytes, it’s extra outstanding within the latter, confirming its affiliation with astrocytic filaments.

Macrophage heterogeneity within the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter recognizing complement receptor kind 3.

Two monoclonal antibodies, designated MRC OX-41 and MRC OX-42, have been proven to label subsets of macrophages. Utilizing immunoperoxidase and immunofluorescence evaluation, tissue macrophages had been proven to be heterogeneous with respect to binding of MRC OX-41 and MRC OX-42 antibodies. Though each antibodies labelled subsets of macrophages, the antibodies additionally reacted with granulocytes and dendritic cells. The antigens acknowledged by these antibodies had been recognized by metabolic and cell floor labelling adopted by immunoprecipitation and sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).

MRC OX-41 acknowledged a floor protein of 110,000-120,000 MW, whereas MRC OX-42 immunoprecipitated three polypeptides with molecular weights of 160,000, 103,000 and 95,000. The Fab fragment of MRC OX-42 antibody inhibited complement-mediated rosette formation between sensitized erythrocytes and rat macrophages and granulocytes. Membrane molecules with comparable biochemical and useful properties to MRC OX-42 antigen have been recognized in mouse and man because the receptors for iC3b, and it’s possible that MRC OX-42 antibody acknowledges the rat homologue of the receptors in these different species.

In heterologous immune advanced glomerulonephritis glomerular deposition of immune complexes happens instantly after an injection with heterologous antibody directed towards antigen, derived from the comb border of the tubules. The injected antibody is believed to mix with circulating Fx1A antigen to type immune complexes which subsequently are deposited within the glomeruli. Nevertheless, perfusion of rat kidneys in absence of this antigen likewise resulted in immediate localization of immune complexes alongside the glomerular basement membrane.

Axonal regeneration in the rat spinal cord produced by an antibody against myelin-associated neurite growth inhibitors.

Identification and preliminary characterization of a rat monoclonal antibody reactive with the murine interleukin 2 receptor-ligand advanced.

Xenogeneic monoclonal antibodies had been ready to the murine interleukin 2 (IL-2)-dependent HT2 cell line. One rat IgM monoclonal antibody (7D4) was recognized that inhibited proliferation of the HT2 cells and of IL-2-dependent CTLL cells within the presence of crude rat IL-2 in addition to of purified human IL-2. The extent of inhibition was depending on each antibody and IL-2 focus. Cell distribution research utilizing a fluorescence-activated cell sorter confirmed that the antigen recognized by 7D4 is expressed at a excessive density on HT2 cells and on concanavalin A (Con A)-induced

Anti-LDLRAD3 antibody
STJ93916 200 µl
EUR 197
Description: Rabbit polyclonal to LDLRAD3.

LDLRAD3 antibody
70R-51775 100 ul
EUR 244
Description: Purified Polyclonal LDLRAD3 antibody

LDLRAD3 antibody
70R-35512 100 ug
EUR 327
Description: Purified Rabbit polyclonal LDLRAD3 antibody

LDLRAD3 antibody
70R-9224 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LDLRAD3 antibody

LDLRAD3 Antibody
39887-100ul 100ul
EUR 390

LDLRAD3 Antibody
34765-100ul 100ul
EUR 252

LDLRAD3 Antibody
34765-50ul 50ul
EUR 187

LDLRAD3 Antibody
1-CSB-PA007326
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/40000

LDLRAD3 Antibody
CSB-PA786511-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

LDLRAD3 Antibody
CSB-PA786511-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349

LDLRAD3 Conjugated Antibody
C34765 100ul
EUR 397

LDLRAD3 Polyclonal Antibody
ES4839-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDLRAD3 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

LDLRAD3 Polyclonal Antibody
ES4839-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDLRAD3 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

LDLRAD3 Polyclonal Antibody
ABP53840-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 Polyclonal Antibody
ABP53840-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 Polyclonal Antibody
ABP53840-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 siRNA
20-abx922395
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LDLRAD3 siRNA
20-abx922396
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LDLRAD3 Blocking Peptide
20-abx162318
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LDLRAD3 Blocking Peptide
33R-1897 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDLRAD3 antibody, catalog no. 70R-9224

LDLRAD3 cloning plasmid
CSB-CL803154HU-10ug 10ug
EUR 401
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: ATGTGGCTGCTGGGGCCGCTGTGCCTGCTGCTGAGCAGCGCCGCGGAGAGCCAGCTGCTCCCCGGGAACAACTTCACCAATGAGTGCAACATACCAGGCAACTTCATGTGCAGCAATGGACGGTGCATCCCGGGCGCCTGGCAGTGTGACGGGCTGCCTGACTGCTTCGACAAGA
  • Show more
Description: A cloning plasmid for the LDLRAD3 gene.

Polyclonal LDLRAD3 antibody - middle region
APR01194G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDLRAD3 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

Human LDLRAD3 shRNA Plasmid
20-abx965371
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Ldlrad3 ELISA KIT
ELI-27814m 96 Tests
EUR 865

Human LDLRAD3 ELISA KIT
ELI-39778h 96 Tests
EUR 824

Mouse LDLRAD3 shRNA Plasmid
20-abx982528
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDLRAD3 Recombinant Protein (Human)
RP040687 100 ug Ask for price

LDLRAD3 Recombinant Protein (Mouse)
RP147182 100 ug Ask for price

anti- ATF2-Specific antibody
FNab00661 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: activating transcription factor 2
  • Uniprot ID: P15336
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2-Specific

anti- ATP1A1-Specific antibody
FNab00692 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: ATPase, Na+/K+ transporting, alpha 1 polypeptide
  • Uniprot ID: P05023
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A1-Specific

anti- ATP1A2-Specific antibody
FNab00694 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATPase, Na+/K+ transporting, alpha 2(+) polypeptide
  • Uniprot ID: P50993
  • Gene ID: 477
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATP1A2-Specific

anti- ATP5G2-Specific antibody
FNab00708 100µg
EUR 505.25
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2(subunit 9)
  • Uniprot ID: Q06055
  • Research Area: Metabolism
Description: Antibody raised against ATP5G2-Specific

anti- BAG1S-specific antibody
FNab00788 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: BCL2-associated athanogene
  • Uniprot ID: Q99933
  • Gene ID: 573
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against BAG1S-specific

anti- BAI2-Specific antibody
FNab00791 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: brain-specific angiogenesis inhibitor 2
  • Uniprot ID: O60241
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against BAI2-Specific

anti- BAI3-Specific antibody
FNab00792 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: brain-specific angiogenesis inhibitor 3
  • Uniprot ID: O60242
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against BAI3-Specific

anti- Barkor-Specific antibody
FNab00806 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IF: 1:10-1:100
  • Immunogen: KIAA0831
  • Uniprot ID: Q6ZNE5
  • Gene ID: 22863
  • Research Area: Cancer, Immunology
Description: Antibody raised against Barkor-Specific

anti- BLOC1S1-Specific antibody
FNab00909 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: biogenesis of lysosomal organelles complex-1, subunit 1
  • Uniprot ID: P78537
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against BLOC1S1-Specific

anti- BRN2-Specific antibody
FNab00963 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: POU class 3 homeobox 2
  • Uniprot ID: P20265
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against BRN2-Specific

anti- CAPG-Specific antibody
FNab01249 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: capping protein(actin filament), gelsolin-like
  • Uniprot ID: P40121
  • Research Area: Signal Transduction, Immunology, epigenetics
Description: Antibody raised against CAPG-Specific

anti- Catalase-Specific antibody
FNab01302 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: catalase
  • Uniprot ID: P04040
  • Gene ID: 847
  • Research Area: Metabolism
Description: Antibody raised against Catalase-Specific

anti- CCKAR-specific antibody
FNab01377 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: cholecystokinin A receptor
  • Uniprot ID: P32238
  • Gene ID: 886
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against CCKAR-specific

anti- CCKBR-specific antibody
FNab01378 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: cholecystokinin B receptor
  • Uniprot ID: P32239
  • Gene ID: 887
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against CCKBR-specific

anti- CCR2-specific antibody
FNab01390 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: chemokine(C-C motif) receptor 2
  • Uniprot ID: P41597
  • Research Area: Cardiovascular, cardiovascular, Cancer, Signal Transduction
Description: Antibody raised against CCR2-specific

anti- CCT6A-Specific antibody
FNab01401 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1)
  • Uniprot ID: P40227
  • Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

anti- CDH10-specific antibody
FNab01546 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: cadherin 10, type 2(T2-cadherin)
  • Uniprot ID: Q9Y6N8
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against CDH10-specific

anti- CDK1-Specific antibody
FNab01552 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:400
  • IF: 1:20-1:200
  • Immunogen: cell division cycle 2, G1 to S and G2 to M
  • Uniprot ID: P06493
  • Research Area: Neuroscience, Metabolism, Immunology, Cell Division and Proliferation
Description: Antibody raised against CDK1-Specific

anti- CEACAM3-Specific antibody
FNab01578 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: carcinoembryonic antigen-related cell adhesion molecule 3
  • Uniprot ID: P40198
  • Research Area: Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CEACAM3-Specific

anti- CEP350-Specific antibody
FNab01603 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: centrosomal protein 350kDa
  • Uniprot ID: Q5VT06
  • Gene ID: 9857
  • Research Area: Signal Transduction, Proliferation, Epigenetics
Description: Antibody raised against CEP350-Specific

anti- CES7-Specific antibody
FNab01618 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:20-1:200
  • Immunogen: carboxylesterase 7
  • Uniprot ID: Q6NT32
  • Research Area: Metabolism
Description: Antibody raised against CES7-Specific

anti- CHST13-Specific antibody
FNab01693 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • IHC: 1:20-1:200
  • Immunogen: carbohydrate(chondroitin 4) sulfotransferase 13
  • Uniprot ID: Q8NET6
  • Research Area: Metabolism
Description: Antibody raised against CHST13-Specific

anti- CISD2-Specific antibody
FNab01719 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:16000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: CDGSH iron sulfur domain 2
  • Uniprot ID: Q8N5K1
  • Research Area: Signal Transduction
Description: Antibody raised against CISD2-Specific

anti- CPNE9-Specific antibody
FNab01932 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: copine family member IX
  • Uniprot ID: Q8IYJ1
  • Research Area: Metabolism
Description: Antibody raised against CPNE9-Specific

anti- CPT1B-specific antibody
FNab01944 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IP: 1:500-1:1000
  • Immunogen: carnitine palmitoyltransferase 1B(muscle)
  • Uniprot ID: Q92523
  • Research Area: Metabolism
Description: Antibody raised against CPT1B-specific

anti- CPT1C-specific antibody
FNab01946 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IP: 1:500-1:1000
  • Immunogen: carnitine palmitoyltransferase 1C
  • Uniprot ID: Q8TCG5
  • Research Area: Metabolism
Description: Antibody raised against CPT1C-specific

anti- CRLS1-Specific antibody
FNab01983 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: cardiolipin synthase 1
  • Uniprot ID: Q9UJA2
  • Research Area: Metabolism
Description: Antibody raised against CRLS1-Specific

anti- CST2-Specific antibody
FNab02033 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: cystatin SA
  • Uniprot ID: P09228
  • Research Area: Metabolism
Description: Antibody raised against CST2-Specific

anti- CSTL1-Specific antibody
FNab02041 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: cystatin-like 1
  • Uniprot ID: Q9H114
  • Research Area: Metabolism
Description: Antibody raised against CSTL1-Specific

anti- CUL4A-Specific antibody
FNab02078 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: cullin 4A
  • Uniprot ID: Q13619
  • Research Area: Metabolism
Description: Antibody raised against CUL4A-Specific

anti- CXCR3B-specific antibody
FNab02101 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: chemokine(C-X-C motif) receptor 3
  • Uniprot ID: P49682
  • Research Area: Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CXCR3B-specific

anti- CXCR7-Specific antibody
FNab02107 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:50-1:500
  • IP: 1:500-1:1000
  • Immunogen: chemokine(C-X-C motif) receptor 7
  • Uniprot ID: P25106
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against CXCR7-Specific

anti- CYP1A2-Specific antibody
FNab02148 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: cytochrome P450, family 1, subfamily A, polypeptide 2
  • Uniprot ID: P05177
  • Gene ID: 1544
  • Research Area: Metabolism
Description: Antibody raised against CYP1A2-Specific

anti- CYP2E1-Specific antibody
FNab02159 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:20-1:200
  • IHC: 1:20-1:200
  • Immunogen: cytochrome P450, family 2, subfamily E, polypeptide 1
  • Uniprot ID: P05181
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CYP2E1-Specific

anti- CYP4F11-Specific antibody
FNab02171 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: cytochrome P450, family 4, subfamily F, polypeptide 11
  • Uniprot ID: Q9HBI6
  • Research Area: Metabolism
Description: Antibody raised against CYP4F11-Specific

anti- CYP4Z1-Specific antibody
FNab02175 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: cytochrome P450, family 4, subfamily Z, polypeptide 1
  • Uniprot ID: Q86W10
  • Research Area: Metabolism
Description: Antibody raised against CYP4Z1-Specific

anti- DAPK2-Specific antibody
FNab02241 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: death-associated protein kinase 2
  • Uniprot ID: Q9UIK4
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against DAPK2-Specific

anti- DCC-Specific antibody
FNab02262 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: deleted in colorectal carcinoma
  • Uniprot ID: P43146
  • Gene ID: 1630
  • Research Area: Neuroscience, Cancer, Signal Transduction, Developmental biology
Description: Antibody raised against DCC-Specific

anti- DGKK-Specific antibody
FNab02360 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: diacylglycerol kinase, kappa
  • Uniprot ID: Q5KSL6
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DGKK-Specific

anti- DLL1-Specific antibody
FNab02415 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: delta-like 1(Drosophila)
  • Uniprot ID: O00548
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology
Description: Antibody raised against DLL1-Specific

anti- DOCK180-Specific antibody
FNab02493 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2400
  • IF: 1:10-1:100
  • Immunogen: dedicator of cytokinesis 1
  • Uniprot ID: Q14185
  • Research Area: Signal Transduction
Description: Antibody raised against DOCK180-Specific

anti- DR5-Specific antibody
FNab02530 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: tumor necrosis factor receptor superfamily, member 10b
  • Uniprot ID: O14763
  • Gene ID: 8795
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against DR5-Specific

anti- EDG7-Specific antibody
FNab02635 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: lysophosphatidic acid receptor 3
  • Uniprot ID: Q9UBY5
  • Research Area: Signal Transduction
Description: Antibody raised against EDG7-Specific

anti- EGFR-Specific antibody
FNab02669 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:4000
  • IP: 1:500-1:1000
  • IHC: 1:200-1:800
  • IF: 1:50-1:500
  • Immunogen: epidermal growth factor receptor
  • Uniprot ID: P00533
  • Gene ID: 1956
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Immunolog
  • Show more
Description: Antibody raised against EGFR-Specific

anti- EIF2C1-Specific antibody
FNab02697 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: eukaryotic translation initiation factor 2C, 1
  • Uniprot ID: Q9UL18
  • Gene ID: 26523
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against EIF2C1-Specific

anti- EIF2C3-Specific antibody
FNab02698 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: eukaryotic translation initiation factor 2C, 3
  • Uniprot ID: Q9H9G7
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against EIF2C3-Specific

anti- EPHA1-specific antibody
FNab02801 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: EPH receptor A1
  • Uniprot ID: P21709
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
Description: Antibody raised against EPHA1-specific

anti- EPHA6-Specific antibody
FNab02804 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: EPH receptor A6
  • Uniprot ID: Q9UF33
  • Gene ID: 285220
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
Description: Antibody raised against EPHA6-Specific

anti- FABP7-Specific antibody
FNab02937 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: fatty acid binding protein 7, brain
  • Uniprot ID: O15540
  • Research Area: Signal Transduction, Metabolism, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against FABP7-Specific

anti- FANCA-Specific antibody
FNab03004 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: Fanconi anemia, complementation group A
  • Uniprot ID: O15360
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against FANCA-Specific

anti- FcRn-Specific antibody
FNab03063 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: Fc fragment of IgG, receptor, transporter, alpha
  • Uniprot ID: P55899
  • Gene ID: 2217
  • Research Area: Neuroscience
Description: Antibody raised against FcRn-Specific

anti- FGF16-Specific antibody
FNab03091 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: fibroblast growth factor 16
  • Uniprot ID: O43320
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against FGF16-Specific

anti- FMO2-specific antibody
FNab03169 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: flavin containing monooxygenase 2(non-functional)
  • Uniprot ID: Q99518
  • Gene ID: 2327
  • Research Area: Metabolism
Description: Antibody raised against FMO2-specific

anti- FMO5-specific antibody
FNab03171 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: flavin containing monooxygenase 5
  • Uniprot ID: P49326
  • Research Area: Metabolism
Description: Antibody raised against FMO5-specific

anti- FOXH1-Specific antibody
FNab03196 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: forkhead box H1
  • Uniprot ID: O75593
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Developmental biology, Neuroscience
Description: Antibody raised against FOXH1-Specific

anti- FOXL2-Specific antibody
FNab03199 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: forkhead box L2
  • Uniprot ID: P58012
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against FOXL2-Specific

anti- GAB3-Specific antibody
FNab03273 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: GRB2-associated binding protein 3
  • Uniprot ID: Q8WWW8
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against GAB3-Specific

anti- GABARAPL1-Specific antibody
FNab03276 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: GABA(A) receptor-associated protein like 1
  • Uniprot ID: Q9H0R8
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GABARAPL1-Specific

anti- GABARAPL2-Specific antibody
FNab03278 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: GABA(A) receptor-associated protein-like 2
  • Uniprot ID: P60520
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GABARAPL2-Specific

anti- GAC-specific antibody
FNab03290 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:100-1:400
  • Immunogen: glutaminase
  • Uniprot ID: O94925
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against GAC-specific

anti- ACADL-Specific antibody
FNab00064 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: acyl-Coenzyme A dehydrogenase, long chain
  • Uniprot ID: P28330
  • Gene ID: 33
  • Research Area: Metabolism
Description: Antibody raised against ACADL-Specific

anti- ACTA1-Specific antibody
FNab00115 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: actin, alpha 1, skeletal muscle
  • Uniprot ID: P68133
  • Gene ID: 58
  • Research Area: Cardiovascular, Immunology, Cancer, Developmental biology, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against ACTA1-Specific

anti- ADAM17-Specific antibody
FNab00139 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ADAM metallopeptidase domain 17
  • Uniprot ID: P78536
  • Gene ID: 6868
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against ADAM17-Specific

anti- ADRA1A-Specific antibody
FNab00177 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:500
  • Immunogen: adrenergic, alpha-1A-, receptor
  • Uniprot ID: P35348
  • Gene ID: 148
  • Research Area: Neuroscience, Cardiovascular, Developmental biology, Signal Transduction
Description: Antibody raised against ADRA1A-Specific

anti- ADRA2B-Specific antibody
FNab00179 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: adrenergic, alpha-2B-, receptor
  • Uniprot ID: P18089
  • Gene ID: 151
  • Research Area: Signal Transduction
Description: Antibody raised against ADRA2B-Specific

anti- AFF1-Specific antibody
FNab00195 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: AF4/FMR2 family, member 1
  • Uniprot ID: P51825
  • Gene ID: 4299
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFF1-Specific

anti- AMPD1-Specific antibody
FNab00370 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: adenosine monophosphate deaminase 1(isoform M)
  • Uniprot ID: P23109
  • Gene ID: 270
  • Research Area: Metabolism
Description: Antibody raised against AMPD1-Specific

anti- ARF5-Specific antibody
FNab00534 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IF: 1:10-1:100
  • Immunogen: ADP-ribosylation factor 5
  • Uniprot ID: P62330
  • Gene ID: 381
  • Research Area: Metabolism
Description: Antibody raised against ARF5-Specific

anti- ARF6-Specific antibody
FNab00535 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:50-1:100
  • IHC: 1:50-1:500
  • Immunogen: ADP-ribosylation factor 6
  • Uniprot ID: P62330
  • Gene ID: 382
  • Research Area: Metabolism
Description: Antibody raised against ARF6-Specific

anti- ARHGEF9-Specific antibody
FNab00565 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: Cdc42 guanine nucleotide exchange factor(GEF) 9
  • Uniprot ID: O43307
  • Gene ID: 23229
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against ARHGEF9-Specific

anti- ARSK-Specific antibody
FNab00613 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: arylsulfatase family, member K
  • Uniprot ID: Q6UWY0
  • Research Area: Metabolism
Description: Antibody raised against ARSK-Specific

anti- TMF1-Specific antibody
FNab08796 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: TATA element modulatory factor 1
  • Uniprot ID: P82094
  • Research Area: Metabolism
Description: Antibody raised against TMF1-Specific

anti- TOP2A-Specific antibody
FNab08868 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: topoisomerase(DNA) II alpha 170kDa
  • Uniprot ID: P11388
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism
Description: Antibody raised against TOP2A-Specific

anti- Tuberin-Specific antibody
FNab09101 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200；IF: 1:10-1:100
  • Immunogen: tuberous sclerosis 2
  • Uniprot ID: P49815
  • Gene ID: 7249
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against Tuberin-Specific

anti- TWIST1-specific antibody
FNab09118 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • Immunogen: twist homolog 1
  • Uniprot ID: Q15672
  • Research Area: Epigenetics, Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against TWIST1-specific

anti- UBASH3A-Specific antibody
FNab09150 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IF: 1:10-1:100；IP: 1:200-1:2000
  • Immunogen: ubiquitin associated and SH3 domain containing, A
  • Uniprot ID: P57075
  • Research Area: Metabolism
Description: Antibody raised against UBASH3A-Specific

anti- UBC9-Specific antibody
FNab09159 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200；IF: 1:10-1:100
  • Immunogen: ubiquitin-conjugating enzyme E2I(UBC9 homolog, yeast)
  • Uniprot ID: P63279
  • Research Area: Epigenetics, Metabolism, Developmental biology, Neuroscience, Cell Division an
  • Show more
Description: Antibody raised against UBC9-Specific

anti- UBN1-Specific antibody
FNab09202 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubinuclein 1
  • Uniprot ID: Q9NPG3
  • Research Area: Metabolism
Description: Antibody raised against UBN1-Specific

anti- UNC5C-Specific antibody
FNab09263 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: unc-5 homolog C(C. elegans)
  • Uniprot ID: O95185
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against UNC5C-Specific

anti- UNC5D-Specific antibody
FNab09264 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: unc-5 homolog D(C. elegans)
  • Uniprot ID: Q6UXZ4
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against UNC5D-Specific

anti- URB1-Specific antibody
FNab09286 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: URB1 ribosome biogenesis 1 homolog(S. cerevisiae)
  • Uniprot ID: O60287
  • Research Area: Metabolism
Description: Antibody raised against URB1-Specific

anti- WASF4-Specific antibody
FNab09469 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000；IF: 1:10-1:100
  • Immunogen: WAS protein family, member 4
  • Uniprot ID: Q8IV90
  • Research Area: Metabolism
Description: Antibody raised against WASF4-Specific

anti- YES1-Specific antibody
FNab09563 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
  • Uniprot ID: P07947
  • Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against YES1-Specific

anti- ZIC4-Specific antibody
FNab09637 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: Zic family member 4
  • Uniprot ID: Q8N9L1
  • Research Area: Neuroscience
Description: Antibody raised against ZIC4-Specific

anti- ZNF600-Specific antibody
FNab09718 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: zinc finger protein 600
  • Uniprot ID: Q6ZNG1
  • Research Area: Metabolism
Description: Antibody raised against ZNF600-Specific

anti- ZNRF2-Specific antibody
FNab09746 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: zinc and ring finger 2
  • Uniprot ID: Q8NHG8
  • Research Area: Neuroscience, Metabolism, Epigenetics
Description: Antibody raised against ZNRF2-Specific

anti- TUBB3 specific antibody
FNab09890 100µg
EUR 548.75
  • Recommended dilution: WB: 1:5000-1:50000
  • IHC: 1:50-1:500
  • Immunogen: AS160
  • Uniprot ID: Q13509
  • Gene ID: 10381
  • Research Area: Signal Transduction
Description: Antibody raised against TUBB3 specific

anti- GLI3-Specific antibody
FNab10099 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50 - 1:500
  • Immunogen: GLI family zinc finger 3
  • Uniprot ID: P10071
  • Gene ID: 2737
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against GLI3-Specific

anti- HIP1-Specific antibody
FNab03870 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:3000
  • IHC: 1:20-1:200
  • Immunogen: huntingtin interacting protein 1
  • Uniprot ID: O00291
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against HIP1-Specific

anti- HMMR-Specific antibody
FNab03936 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: hyaluronan-mediated motility receptor(RHAMM)
  • Uniprot ID: O75330
  • Research Area: Immunology
Description: Antibody raised against HMMR-Specific

anti- HNRNPUL2-Specific antibody
FNab03961 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:50-1:500
  • Immunogen: heterogeneous nuclear ribonucleoprotein U-like 2
  • Uniprot ID: Q1KMD3
  • Research Area: Metabolism
Description: Antibody raised against HNRNPUL2-Specific

anti- HRAS-Specific antibody
FNab04008 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP:1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: v-Ha-ras Harvey rat sarcoma viral oncogene homolog
  • Uniprot ID: P01112
  • Research Area: Cancer, Immunology, Signal Transduction, Cell Division and Proli
  • Show more
Description: Antibody raised against HRAS-Specific

anti- HSPG2-Specific antibody
FNab04063 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: heparan sulfate proteoglycan 2
  • Uniprot ID: P98160
  • Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against HSPG2-Specific

anti- IFITM1-Specific antibody
FNab04141 100µg
EUR 585
  • Recommended dilution: WB: 1:5000 - 1:50000
  • IHC: 1:200 - 1:1000
  • IP: 1:500 - 1:1000
  • Immunogen: interferon induced transmembrane protein 1(9-27)
  • Uniprot ID: P13164
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against IFITM1-Specific

anti- IFITM2-specific antibody
FNab04143 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: interferon induced transmembrane protein 2
  • Uniprot ID: Q01629
  • Research Area: Immunology
Description: Antibody raised against IFITM2-specific

anti- IGF1B-Specific antibody
FNab04169 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:20 - 1:200
  • Immunogen: insulin-like growth factor 1(somatomedin C)
  • Uniprot ID: P05019
  • Gene ID: 3479
  • Research Area: Signal Transduction, Metabolism, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against IGF1B-Specific

anti- IGF2R-Specific antibody
FNab04174 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:4000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: insulin-like growth factor 2 receptor
  • Uniprot ID: P11717
  • Research Area: Cancer, Immunology, Signal Transduction
Description: Antibody raised against IGF2R-Specific

anti- ING1-specific antibody
FNab04309 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000；IP: 1:200-1:1000
  • Immunogen: inhibitor of growth family, member 1
  • Uniprot ID: Q9UK53
  • Research Area: Cancer
Description: Antibody raised against ING1-specific

anti- ING3-specific antibody
FNab04312 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2400
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3-specific

anti- ING4-specific antibody
FNab04314 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: inhibitor of growth family, member 4
  • Uniprot ID: Q9UNL4
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING4-specific

T-cell blasts and at a considerably decrease density on lipopolysaccharide-induced B-cell blasts; 7D4 binding was not detected on better than 95% of nonactivated thymocytes, T cells, or B cells. Competitors binding research indicated that 7D4 fails to inhibit the binding of 3H-labeled human IL-2 to CTLL cells. Nevertheless, 7D4 particularly immunoprecipitated 3H-labeled human IL-2 from detergent extracts of HT2 cells or Con A-induced T-cell blasts that had been pulsed with [3H]IL-2; in distinction, 7D4 didn’t react with free [3H]IL-2. Preliminary biochemical evaluation of immunoprecipitates with 7D4 of detergent extracts from surface-iodinated Con A-activated spleen cells confirmed a serious band having obvious molecular weight of 48,000-62,000.