BCL7C Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

BCL7C Polyclonal Antibody
ABP57895-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
ABP57895-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
ABP57895-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
ES10760-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BCL7C from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
BCL7C Polyclonal Antibody
ES10760-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BCL7C from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Polyclonal BCL7C polyclonal antibody
APR00452G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCL7C polyclonal . This antibody is tested and proven to work in the following applications:
BCL7C Polyclonal Conjugated Antibody
C42666 100ul
EUR 397
BCL7C antibody
70R-15981 50 ul
EUR 435
Description: Rabbit polyclonal BCL7C antibody
BCL7C Antibody
1-CSB-PA845147DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
BCL7C Antibody
1-CSB-PA002629GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
BCL7C Antibody
DF2587 200ul
EUR 304
Description: BCL7C antibody detects endogenous levels of total BCL7C.
BCL7C Antibody
ABD2587 100 ug
EUR 438
Anti-BCL7C antibody
STJ191918 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BCL7C
BCL7C Protein
20-abx262722
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
BCL7C siRNA
20-abx909000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BCL7C siRNA
20-abx909001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-BCL7C
YF-PA16209 50 ul
EUR 363
Description: Mouse polyclonal to BCL7C
BCL7C Blocking Peptide
DF2587-BP 1mg
EUR 195
BCL7C cloning plasmid
CSB-CL845147HU1-10ug 10ug
EUR 293
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.
BCL7C cloning plasmid
CSB-CL845147HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.
Anti-BCL7C (5F1)
YF-MA16761 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C
Anti-BCL7C (1A4)
YF-MA16762 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C
BCL Tumor Suppressor 7C (BCL7C) Antibody
20-abx111193
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
BCL7C protein (His tag)
80R-3579 50 ug
EUR 424
Description: Purified recombinant BCL7C protein (His tag)
Mouse Bcl7c ELISA KIT
ELI-25376m 96 Tests
EUR 865
Human BCL7C shRNA Plasmid
20-abx956140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse BCL7C shRNA Plasmid
20-abx969338
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human BCL7C ELISA KIT
ELI-49954h 96 Tests
EUR 824
BCL7C Recombinant Protein (Human)
RP002959 100 ug Ask for price
BCL7C Recombinant Protein (Human)
RP002962 100 ug Ask for price
BCL7C Recombinant Protein (Rat)
RP192053 100 ug Ask for price
BCL7C Recombinant Protein (Mouse)
RP119345 100 ug Ask for price
Monoclonal BCL7C Antibody (monoclonal) (M01), Clone: 5F1
AMM03284G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BCL7C (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F1. This antibody is applicable in WB, E
Bcl7c ORF Vector (Rat) (pORF)
ORF064019 1.0 ug DNA
EUR 506
BCL7C ORF Vector (Human) (pORF)
ORF000987 1.0 ug DNA
EUR 95
BCL7C ORF Vector (Human) (pORF)
ORF000988 1.0 ug DNA
EUR 95
Bcl7c ORF Vector (Mouse) (pORF)
ORF039783 1.0 ug DNA
EUR 506
Bcl7c sgRNA CRISPR Lentivector set (Rat)
K6627601 3 x 1.0 ug
EUR 339
Bcl7c sgRNA CRISPR Lentivector set (Mouse)
K3239201 3 x 1.0 ug
EUR 339
BCL7C sgRNA CRISPR Lentivector set (Human)
K0176601 3 x 1.0 ug
EUR 339
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6627602 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6627603 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6627604 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3239202 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3239203 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3239204 1.0 ug DNA
EUR 154
BCL7C sgRNA CRISPR Lentivector (Human) (Target 1)
K0176602 1.0 ug DNA
EUR 154
BCL7C sgRNA CRISPR Lentivector (Human) (Target 2)
K0176603 1.0 ug DNA
EUR 154
BCL7C sgRNA CRISPR Lentivector (Human) (Target 3)
K0176604 1.0 ug DNA
EUR 154
BCL7C Protein Vector (Mouse) (pPB-C-His)
PV159130 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPB-N-His)
PV159131 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPM-C-HA)
PV159132 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPM-C-His)
PV159133 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPB-C-His)
PV256074 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPB-N-His)
PV256075 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPM-C-HA)
PV256076 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPM-C-His)
PV256077 500 ng
EUR 603
BCL7C Protein Vector (Human) (pPB-His-MBP)
PV326594 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-GST)
PV326595 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-MBP)
PV326598 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-GST)
PV326599 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-C-His)
PV003945 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-N-His)
PV003946 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-HA)
PV003947 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-His)
PV003948 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-C-His)
PV003949 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-N-His)
PV003950 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-HA)
PV003951 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-His)
PV003952 500 ng
EUR 329
Recombinant Human BCL7C Protein, His, E.coli-10ug
QP11147-10ug 10ug
EUR 201
Recombinant Human BCL7C Protein, His, E.coli-1mg
QP11147-1mg 1mg
EUR 5251
Recombinant Human BCL7C Protein, His, E.coli-2ug
QP11147-2ug 2ug
EUR 155
Bcl7c 3'UTR GFP Stable Cell Line
TU152696 1.0 ml Ask for price
Bcl7c 3'UTR Luciferase Stable Cell Line
TU102696 1.0 ml Ask for price
Bcl7c 3'UTR Luciferase Stable Cell Line
TU201284 1.0 ml Ask for price
Bcl7c 3'UTR GFP Stable Cell Line
TU251284 1.0 ml Ask for price
BCL7C 3'UTR GFP Stable Cell Line
TU051707 1.0 ml
EUR 1394
BCL7C 3'UTR Luciferase Stable Cell Line
TU001707 1.0 ml
EUR 1394
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
BCL7C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV707823 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV707827 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV707828 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621379 1.0 ug DNA
EUR 514
BCL7C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621383 1.0 ug DNA
EUR 514
BCL7C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621384 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

BCL7C Rabbit Polyclonal Antibody