CANT1 Rabbit Polyclonal Antibody

Order Now:

CANT1 Polyclonal Antibody

ES10763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CANT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CANT1 Polyclonal Antibody

ES10763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CANT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CANT1 Rabbit pAb

A10965-100ul 100 ul
EUR 308

CANT1 Rabbit pAb

A10965-200ul 200 ul
EUR 459

CANT1 Rabbit pAb

A10965-20ul 20 ul Ask for price

CANT1 Rabbit pAb

A10965-50ul 50 ul Ask for price

CANT1 Rabbit pAb

A14157-100ul 100 ul
EUR 308

CANT1 Rabbit pAb

A14157-200ul 200 ul
EUR 459

CANT1 Rabbit pAb

A14157-20ul 20 ul
EUR 183

CANT1 Rabbit pAb

A14157-50ul 50 ul
EUR 223

CANT1 Rabbit pAb

A6341-100ul 100 ul
EUR 308

CANT1 Rabbit pAb

A6341-200ul 200 ul
EUR 459

CANT1 Rabbit pAb

A6341-20ul 20 ul
EUR 183

CANT1 Rabbit pAb

A6341-50ul 50 ul
EUR 223

CANT1 antibody

70R-16146 50 ul
EUR 435
Description: Rabbit polyclonal CANT1 antibody

CANT1 antibody

38838-100ul 100ul
EUR 252

CANT1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CANT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CANT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CANT1 Antibody

DF2590 200ul
EUR 304
Description: CANT1 antibody detects endogenous levels of total CANT1.

CANT1 antibody

70R-5808 50 ug
EUR 467
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1

CANT1 antibody

70R-5814 50 ug
EUR 467
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1

CANT1 Antibody

ABD2590 100 ug
EUR 438

Polyclonal CANT1 Antibody (N-term)

APR15248G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CANT1 (N-term). This antibody is tested and proven to work in the following applications:

CANT1 Polyclonal Antibody, HRP Conjugated

A55891 100 µg
EUR 570.55
Description: Ask the seller for details

CANT1 Polyclonal Antibody, FITC Conjugated

A55892 100 µg
EUR 570.55
Description: The best epigenetics products

CANT1 Polyclonal Antibody, Biotin Conjugated

A55893 100 µg
EUR 570.55
Description: kits suitable for this type of research

CANT1 Conjugated Antibody

C38838 100ul
EUR 397

anti- CANT1 antibody

FNab01245 100µg
EUR 548.75
  • Immunogen: calcium activated nucleotidase 1
  • Uniprot ID: Q8WVQ1
  • Gene ID: 124583
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CANT1

Anti-CANT1 antibody

PAab01245 100 ug
EUR 386

Anti-CANT1 antibody

STJ28263 100 µl
EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Anti-CANT1 antibody

STJ112854 100 µl
EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Anti-CANT1 antibody

STJ116092 100 µl
EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Anti-CANT1 antibody

STJ191921 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CANT1

Cant1/ Rat Cant1 ELISA Kit

ELI-11219r 96 Tests
EUR 886

Cant1 protein

30R-3248 50 ug
EUR 257
Description: Purified recombinant Cant1 protein

Cant1 protein

30R-3249 50 ug
EUR 257
Description: Purified recombinant Cant1 protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22085 50 ul
EUR 363
Description: Mouse polyclonal to CANT1


YF-PA22086 100 ul
EUR 403
Description: Rabbit polyclonal to CANT1


YF-PA22087 100 ug
EUR 403
Description: Rabbit polyclonal to CANT1

CANT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CANT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CANT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1)

CANT1 Blocking Peptide

33R-8666 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5808

CANT1 Blocking Peptide

33R-9442 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5814

CANT1 Blocking Peptide

DF2590-BP 1mg
EUR 195

CANT1 cloning plasmid

CSB-CL848824HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1206
  • Sequence: atgcccgtgcagctgtctgagcacccggaatggaatgagtctatgcactccctccggatcagtgtggggggccttcctgtgctggcgtccatgaccaaggccgcggacccccgcttccgcccccgctggaaggtgatcctgacgttctttgtgggtgctgccatcctctggctgc
  • Show more
Description: A cloning plasmid for the CANT1 gene.


PVT13149 2 ug
EUR 391

Anti-CANT1 (2D3)

YF-MA19809 100 ug
EUR 363
Description: Mouse monoclonal to CANT1

Anti-CANT1 (1A1)

YF-MA19810 100 ug
EUR 363
Description: Mouse monoclonal to CANT1

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1)

Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Ile107~Phe400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE.

CANT1 protein (His tag)

80R-2080 50 ug
EUR 424
Description: Recombinant human CANT1 protein (His tag)


EF008369 96 Tests
EUR 689

Rat CANT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CANT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CANT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CANT1 Recombinant Protein (Human)

RP005545 100 ug Ask for price

CANT1 Recombinant Protein (Rat)

RP193031 100 ug Ask for price

CANT1 Recombinant Protein (Mouse)

RP120992 100 ug Ask for price

CANT1 Recombinant Protein (Mouse)

RP120995 100 ug Ask for price

CANT1 Recombinant Protein (Mouse)

RP120998 100 ug Ask for price

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CANT1 (Val111~Ile403)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

abx034122-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

abx034122-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Monoclonal CANT1 Antibody (monoclonal) (M01), Clone: 2D3

APR15247G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CANT1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB, E

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody

abx231245-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human CANT1 PicoKine ELISA Kit

EK2109 96 wells
EUR 425
Description: For quantitative detection of human CANT1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Cant1 ORF Vector (Rat) (pORF)

ORF064345 1.0 ug DNA
EUR 506

CANT1 ORF Vector (Human) (pORF)

ORF001849 1.0 ug DNA
EUR 95

Cant1 ORF Vector (Mouse) (pORF)

ORF040332 1.0 ug DNA
EUR 506

Cant1 ORF Vector (Mouse) (pORF)

ORF040333 1.0 ug DNA
EUR 506

Cant1 ORF Vector (Mouse) (pORF)

ORF040334 1.0 ug DNA
EUR 506

CANT1 ELISA Kit (Human) (OKBB01475)

OKBB01475 96 Wells
EUR 505
Description: Description of target: CANT1 is a gene that encodes soluble calcium-activated nucleotidase 1, an enzyme, in humans. It is mapped to 17q25.3. This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody Pair

abx117542-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

CANT1 sgRNA CRISPR Lentivector set (Human)

K0359301 3 x 1.0 ug
EUR 339

Cant1 sgRNA CRISPR Lentivector set (Rat)

K7219001 3 x 1.0 ug
EUR 339

Cant1 sgRNA CRISPR Lentivector set (Mouse)

K4462001 3 x 1.0 ug
EUR 339

Recombinant Calcium Activated Nucleotidase 1 (CANT1)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WVQ1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calcium Activated Nucleotidase 1 expressed in: E.coli

Recombinant Calcium Activated Nucleotidase 1 (CANT1)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VCF1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Calcium Activated Nucleotidase 1 expressed in: E.coli

Human Soluble calcium-activated nucleotidase 1 (CANT1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli

Human Soluble calcium-activated nucleotidase 1 (CANT1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli

Human Calcium Activated Nucleotidase 1 (CANT1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Calcium Activated Nucleotidase 1 (CANT1) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CANT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0359302 1.0 ug DNA
EUR 154

CANT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0359303 1.0 ug DNA
EUR 154

CANT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0359304 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7219002 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7219003 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7219004 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4462002 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4462003 1.0 ug DNA
EUR 154

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4462004 1.0 ug DNA
EUR 154

CANT1 Protein Vector (Mouse) (pPB-C-His)

PV161326 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)

PV161327 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)

PV161328 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)

PV161329 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPB-C-His)

PV161330 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)

PV161331 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)

PV161332 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)

PV161333 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPB-C-His)

PV161334 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)

PV161335 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)

PV161336 500 ng
EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)

PV161337 500 ng
EUR 603

CANT1 Protein Vector (Rat) (pPB-C-His)

PV257378 500 ng
EUR 603

CANT1 Rabbit Polyclonal Antibody