CANT1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CANT1 Polyclonal Antibody |
ES10763-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CANT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CANT1 Polyclonal Antibody |
ES10763-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CANT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CANT1 Rabbit pAb |
A10965-100ul |
Abclonal |
100 ul |
EUR 308 |
CANT1 Rabbit pAb |
A10965-200ul |
Abclonal |
200 ul |
EUR 459 |
CANT1 Rabbit pAb |
A10965-20ul |
Abclonal |
20 ul |
Ask for price |
CANT1 Rabbit pAb |
A10965-50ul |
Abclonal |
50 ul |
Ask for price |
CANT1 Rabbit pAb |
A14157-100ul |
Abclonal |
100 ul |
EUR 308 |
CANT1 Rabbit pAb |
A14157-200ul |
Abclonal |
200 ul |
EUR 459 |
CANT1 Rabbit pAb |
A14157-20ul |
Abclonal |
20 ul |
EUR 183 |
CANT1 Rabbit pAb |
A14157-50ul |
Abclonal |
50 ul |
EUR 223 |
CANT1 Rabbit pAb |
A6341-100ul |
Abclonal |
100 ul |
EUR 308 |
CANT1 Rabbit pAb |
A6341-200ul |
Abclonal |
200 ul |
EUR 459 |
CANT1 Rabbit pAb |
A6341-20ul |
Abclonal |
20 ul |
EUR 183 |
CANT1 Rabbit pAb |
A6341-50ul |
Abclonal |
50 ul |
EUR 223 |
CANT1 antibody |
70R-16146 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CANT1 antibody |
CANT1 antibody |
38838-100ul |
SAB |
100ul |
EUR 252 |
CANT1 Antibody |
1-CSB-PA848824ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CANT1 Antibody |
1-CSB-PA004484GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CANT1 Antibody |
1-CSB-PA13099A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
CANT1 Antibody |
DF2590 |
Affbiotech |
200ul |
EUR 304 |
Description: CANT1 antibody detects endogenous levels of total CANT1. |
CANT1 antibody |
70R-5808 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1 |
CANT1 antibody |
70R-5814 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1 |
Polyclonal CANT1 Antibody (N-term) |
APR15248G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CANT1 (N-term). This antibody is tested and proven to work in the following applications: |
CANT1 Polyclonal Antibody, HRP Conjugated |
A55891 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CANT1 Polyclonal Antibody, FITC Conjugated |
A55892 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CANT1 Polyclonal Antibody, Biotin Conjugated |
A55893 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CANT1 Conjugated Antibody |
C38838 |
SAB |
100ul |
EUR 397 |
anti- CANT1 antibody |
FNab01245 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: calcium activated nucleotidase 1
- Uniprot ID: Q8WVQ1
- Gene ID: 124583
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against CANT1 |
Anti-CANT1 antibody |
STJ28263 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene. |
Anti-CANT1 antibody |
STJ112854 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene. |
Anti-CANT1 antibody |
STJ116092 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene. |
Anti-CANT1 antibody |
STJ191921 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CANT1 |
Cant1 protein |
30R-3248 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant Cant1 protein |
Cant1 protein |
30R-3249 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant Cant1 protein |
CANT1 siRNA |
20-abx900773 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CANT1 siRNA |
20-abx910225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CANT1 siRNA |
20-abx910226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CANT1 |
YF-PA22085 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CANT1 |
anti-CANT1 |
YF-PA22086 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CANT1 |
anti-CANT1 |
YF-PA22087 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CANT1 |
CANT1 Antibody, HRP conjugated |
1-CSB-PA13099B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CANT1 Antibody, FITC conjugated |
1-CSB-PA13099C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CANT1 Antibody, Biotin conjugated |
1-CSB-PA13099D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human) |
4-PAC357Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1) |
CANT1 Blocking Peptide |
33R-8666 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5808 |
CANT1 Blocking Peptide |
33R-9442 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5814 |
CANT1 Blocking Peptide |
DF2590-BP |
Affbiotech |
1mg |
EUR 195 |
CANT1 cloning plasmid |
CSB-CL848824HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1206
- Sequence: atgcccgtgcagctgtctgagcacccggaatggaatgagtctatgcactccctccggatcagtgtggggggccttcctgtgctggcgtccatgaccaaggccgcggacccccgcttccgcccccgctggaaggtgatcctgacgttctttgtgggtgctgccatcctctggctgc
- Show more
|
Description: A cloning plasmid for the CANT1 gene. |
Anti-CANT1 (2D3) |
YF-MA19809 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CANT1 |
Anti-CANT1 (1A1) |
YF-MA19810 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CANT1 |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC |
4-PAC357Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Biotinylated |
4-PAC357Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Cy3 |
4-PAC357Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), FITC |
4-PAC357Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), HRP |
4-PAC357Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), PE |
4-PAC357Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse) |
4-PAC357Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1) |
Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx111298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx131557 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx131558 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx109378 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx270288 |
Abbexa |
-
EUR 495.00
-
EUR 578.00
-
EUR 286.00
-
EUR 885.00
-
EUR 370.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-7 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC357Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Ile107~Phe400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC |
4-PAC357Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC357Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC357Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC357Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC357Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP. |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), PE |
4-PAC357Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE. |
CANT1 protein (His tag) |
80R-2080 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Recombinant human CANT1 protein (His tag) |
Rat CANT1 shRNA Plasmid |
20-abx987972 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CANT1 shRNA Plasmid |
20-abx978539 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CANT1 shRNA Plasmid |
20-abx964771 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CANT1 Recombinant Protein (Human) |
RP005545 |
ABM |
100 ug |
Ask for price |
CANT1 Recombinant Protein (Rat) |
RP193031 |
ABM |
100 ug |
Ask for price |
CANT1 Recombinant Protein (Mouse) |
RP120992 |
ABM |
100 ug |
Ask for price |
CANT1 Recombinant Protein (Mouse) |
RP120995 |
ABM |
100 ug |
Ask for price |
CANT1 Recombinant Protein (Mouse) |
RP120998 |
ABM |
100 ug |
Ask for price |
Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC357Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CANT1 (Val111~Ile403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7. |
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx004847 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody (Biotin) |
20-abx105925 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody (FITC) |
20-abx107340 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calcium Activated Nucleotidase 1 (CANT1) Antibody (HRP) |
20-abx108761 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx126849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
abx034122-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
abx034122-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Monoclonal CANT1 Antibody (monoclonal) (M01), Clone: 2D3 |
APR15247G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CANT1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB, E |
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
20-abx320170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody |
abx231245-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human CANT1 PicoKine ELISA Kit |
EK2109 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human CANT1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate). |
Cant1 ORF Vector (Rat) (pORF) |
ORF064345 |
ABM |
1.0 ug DNA |
EUR 506 |
CANT1 ORF Vector (Human) (pORF) |
ORF001849 |
ABM |
1.0 ug DNA |
EUR 95 |
Cant1 ORF Vector (Mouse) (pORF) |
ORF040332 |
ABM |
1.0 ug DNA |
EUR 506 |
Cant1 ORF Vector (Mouse) (pORF) |
ORF040333 |
ABM |
1.0 ug DNA |
EUR 506 |
Cant1 ORF Vector (Mouse) (pORF) |
ORF040334 |
ABM |
1.0 ug DNA |
EUR 506 |
CANT1 ELISA Kit (Human) (OKBB01475) |
OKBB01475 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: CANT1 is a gene that encodes soluble calcium-activated nucleotidase 1, an enzyme, in humans. It is mapped to 17q25.3. This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody Pair |
abx117542-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
CANT1 sgRNA CRISPR Lentivector set (Human) |
K0359301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cant1 sgRNA CRISPR Lentivector set (Rat) |
K7219001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cant1 sgRNA CRISPR Lentivector set (Mouse) |
K4462001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Calcium Activated Nucleotidase 1 (CANT1) |
4-RPC357Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8WVQ1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Calcium Activated Nucleotidase 1 expressed in: E.coli |
Recombinant Calcium Activated Nucleotidase 1 (CANT1) |
4-RPC357Mu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8VCF1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Calcium Activated Nucleotidase 1 expressed in: E.coli |
Human Soluble calcium-activated nucleotidase 1 (CANT1) |
1-CSB-RP130944h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 62.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli |
Human Soluble calcium-activated nucleotidase 1 (CANT1) |
1-CSB-RP130994h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli |
Human Calcium Activated Nucleotidase 1 (CANT1) Protein |
20-abx168919 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Calcium Activated Nucleotidase 1 (CANT1) Protein |
20-abx168920 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CANT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0359302 |
ABM |
1.0 ug DNA |
EUR 154 |
CANT1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0359303 |
ABM |
1.0 ug DNA |
EUR 154 |
CANT1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0359304 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7219002 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7219003 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7219004 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4462002 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4462003 |
ABM |
1.0 ug DNA |
EUR 154 |
Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4462004 |
ABM |
1.0 ug DNA |
EUR 154 |
CANT1 Protein Vector (Mouse) (pPB-C-His) |
PV161326 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPB-N-His) |
PV161327 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-HA) |
PV161328 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-His) |
PV161329 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPB-C-His) |
PV161330 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPB-N-His) |
PV161331 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-HA) |
PV161332 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-His) |
PV161333 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPB-C-His) |
PV161334 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPB-N-His) |
PV161335 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-HA) |
PV161336 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Mouse) (pPM-C-His) |
PV161337 |
ABM |
500 ng |
EUR 603 |
CANT1 Protein Vector (Rat) (pPB-C-His) |
PV257378 |
ABM |
500 ng |
EUR 603 |
CANT1 Rabbit Polyclonal Antibody