CCNI Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CCNI Polyclonal Antibody
ABP58020-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCNI from Human, Mouse. This CCNI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110

CCNI Polyclonal Antibody
ABP58020-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCNI from Human, Mouse. This CCNI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110

CCNI Polyclonal Antibody
ABP58020-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCNI from Human, Mouse. This CCNI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCNI protein at amino acid sequence of 30-110

CCNI Rabbit pAb
A17623-100ul 100 ul
EUR 308

CCNI Rabbit pAb
A17623-200ul 200 ul
EUR 459

CCNI Rabbit pAb
A17623-20ul 20 ul
EUR 183

CCNI Rabbit pAb
A17623-50ul 50 ul
EUR 223

CCNI Antibody
ABD10025 100 ug
EUR 438

CCNI Antibody
44457-100ul 100ul
EUR 252

CCNI Antibody
44457-50ul 50ul
EUR 187

CCNI antibody
70R-16239 50 ul
EUR 435
Description: Rabbit polyclonal CCNI antibody

CCNI Antibody
DF10025 200ul
EUR 304
Description: CCNI Antibody detects endogenous levels of total CCNI.

CCNI Antibody
1-CSB-PA004823GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNI. Recognizes CCNI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

CCNI Conjugated Antibody
C44457 100ul
EUR 397

Anti-CCNI antibody
STJ119685 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]

Anti-CCNI antibody
STJ191666 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCNI

CCNI siRNA
20-abx910841
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCNI siRNA
20-abx910842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-CCNI
PVT18373 2 ug
EUR 231

Rabbit Cyclin I(CCNI) ELISA kit
E04C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin I(CCNI) ELISA kit
E04C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin I(CCNI) ELISA kit
E04C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cyclin-I (CCNI) Antibody
20-abx149018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCNI Blocking Peptide
DF10025-BP 1mg
EUR 195

CCNI cloning plasmid
CSB-CL623898HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgaagtttccagggcctttggaaaaccagagattgtctttcctgttggaaaaggcaatcactagggaagcacagatgtggaaagtgaatgtgcggaaaatgccttcaaatcagaatgtttctccatcccagagagatgaagtaattcaatggctggccaaactcaagtaccaat
  • Show more
Description: A cloning plasmid for the CCNI gene.

Human Cyclin-I (CCNI) Antibody
31021-05111 150 ug
EUR 261

Human CCNI shRNA Plasmid
20-abx957500
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCNI shRNA Plasmid
20-abx969531
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCNI Recombinant Protein (Human)
RP006202 100 ug Ask for price

CCNI Recombinant Protein (Rat)
RP193733 100 ug Ask for price

CCNI Recombinant Protein (Mouse)
RP122195 100 ug Ask for price

Human Cyclin-I (CCNI) Antibody (Biotin Conjugate)
31021-05121 150 ug
EUR 369

CCNI ORF Vector (Human) (pORF)
ORF002068 1.0 ug DNA
EUR 95

Ccni ORF Vector (Mouse) (pORF)
ORF040733 1.0 ug DNA
EUR 506

Ccni ORF Vector (Rat) (pORF)
ORF064579 1.0 ug DNA
EUR 506

Human Cyclin-I (CCNI) AssayLite Antibody (FITC Conjugate)
31021-05141 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (RPE Conjugate)
31021-05151 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (APC Conjugate)
31021-05161 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (PerCP Conjugate)
31021-05171 150 ug
EUR 471

Goat Cyclin I(CCNI) ELISA kit
E06C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin I(CCNI) ELISA kit
E06C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin I(CCNI) ELISA kit
E06C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin I(CCNI) ELISA kit
E02C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin I(CCNI) ELISA kit
E02C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin I(CCNI) ELISA kit
E02C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit
E03C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit
E03C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit
E03C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit
E01C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit
E01C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit
E01C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit
E07C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit
E07C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit
E07C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit
E08C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit
E08C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit
E08C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin I(CCNI) ELISA kit
E09C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin I(CCNI) ELISA kit
E09C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin I(CCNI) ELISA kit
E09C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin- I, CCNI ELISA KIT
ELI-10451h 96 Tests
EUR 824

Mouse Cyclin- I, Ccni ELISA KIT
ELI-25442m 96 Tests
EUR 865

CCNI sgRNA CRISPR Lentivector set (Human)
K0393201 3 x 1.0 ug
EUR 339

Human Cyclin I (CCNI) ELISA Kit
abx259517-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Ccni sgRNA CRISPR Lentivector set (Mouse)
K4975701 3 x 1.0 ug
EUR 339

Ccni sgRNA CRISPR Lentivector set (Rat)
K6501101 3 x 1.0 ug
EUR 339

Human Cyclin I(CCNI)ELISA Kit
QY-E00931 96T
EUR 361

CCNI Cyclin-I Human Recombinant Protein
PROTQ14094 Regular: 20ug
EUR 317
Description: CCNI Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 400 amino acids (1-377 a.a) and having a molecular mass of 44.9kDa.;CCNI is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guinea pig Cyclin I(CCNI) ELISA kit
E05C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin I(CCNI) ELISA kit
E05C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin I(CCNI) ELISA kit
E05C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCNI sgRNA CRISPR Lentivector (Human) (Target 1)
K0393202 1.0 ug DNA
EUR 154

CCNI sgRNA CRISPR Lentivector (Human) (Target 2)
K0393203 1.0 ug DNA
EUR 154

CCNI sgRNA CRISPR Lentivector (Human) (Target 3)
K0393204 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4975702 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4975703 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4975704 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 1)
K6501102 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 2)
K6501103 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 3)
K6501104 1.0 ug DNA
EUR 154

Recombinant Human CCNI Protein, His, E.coli-1mg
QP11298-1mg 1mg
EUR 2757

Recombinant Human CCNI Protein, His, E.coli-20ug
QP11298-20ug 20ug
EUR 201

Recombinant Human CCNI Protein, His, E.coli-5ug
QP11298-5ug 5ug
EUR 155

CCNI Protein Vector (Human) (pPB-C-His)
PV008269 500 ng
EUR 329

CCNI Protein Vector (Human) (pPB-N-His)
PV008270 500 ng
EUR 329

CCNI Protein Vector (Human) (pPM-C-HA)
PV008271 500 ng
EUR 329

CCNI Protein Vector (Human) (pPM-C-His)
PV008272 500 ng
EUR 329

CCNI Protein Vector (Rat) (pPB-C-His)
PV258314 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPB-N-His)
PV258315 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPM-C-HA)
PV258316 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPM-C-His)
PV258317 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPB-C-His)
PV162930 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPB-N-His)
PV162931 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPM-C-HA)
PV162932 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPM-C-His)
PV162933 500 ng
EUR 603

Ccni 3'UTR Luciferase Stable Cell Line
TU201895 1.0 ml Ask for price

Ccni 3'UTR GFP Stable Cell Line
TU153409 1.0 ml Ask for price

CCNI 3'UTR Luciferase Stable Cell Line
TU003797 1.0 ml
EUR 1394

Ccni 3'UTR Luciferase Stable Cell Line
TU103409 1.0 ml Ask for price

CCNI 3'UTR GFP Stable Cell Line
TU053797 1.0 ml
EUR 1394

Ccni 3'UTR GFP Stable Cell Line
TU251895 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CCNI Rabbit Polyclonal Antibody