CDC42 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CDC42 Polyclonal Antibody |
ES10520-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CDC42 Polyclonal Antibody |
ABP58078-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of CDC42 from Human, Mouse, Rat. This CDC42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160 |
CDC42 Polyclonal Antibody |
ABP58078-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of CDC42 from Human, Mouse, Rat. This CDC42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160 |
CDC42 Polyclonal Antibody |
ABP58078-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of CDC42 from Human, Mouse, Rat. This CDC42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160 |
CDC42 Polyclonal Antibody |
A62234 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CDC42 Rabbit pAb |
A1188-100ul |
Abclonal |
100 ul |
EUR 308 |
CDC42 Rabbit pAb |
A1188-200ul |
Abclonal |
200 ul |
EUR 459 |
CDC42 Rabbit pAb |
A1188-20ul |
Abclonal |
20 ul |
EUR 183 |
CDC42 Rabbit pAb |
A1188-50ul |
Abclonal |
50 ul |
EUR 223 |
CDC42 Rabbit pAb |
A15657-100ul |
Abclonal |
100 ul |
EUR 308 |
CDC42 Rabbit pAb |
A15657-200ul |
Abclonal |
200 ul |
EUR 459 |
CDC42 Rabbit pAb |
A15657-20ul |
Abclonal |
20 ul |
EUR 183 |
CDC42 Rabbit pAb |
A15657-50ul |
Abclonal |
50 ul |
EUR 223 |
CDC42 Rabbit mAb |
A19028-100ul |
Abclonal |
100 ul |
EUR 410 |
CDC42 Rabbit mAb |
A19028-200ul |
Abclonal |
200 ul |
EUR 571 |
CDC42 Rabbit mAb |
A19028-20ul |
Abclonal |
20 ul |
EUR 221 |
CDC42 Rabbit mAb |
A19028-50ul |
Abclonal |
50 ul |
EUR 287 |
Polyclonal cdc42/Rac Antibody |
APR00020G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human cdc42/Rac . This antibody is tested and proven to work in the following applications: |
Polyclonal CDC42 Antibody (Center) |
APR05822G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDC42 (Center). This antibody is tested and proven to work in the following applications: |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
DLR-CDC42-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cell Division Cycle Protein 42 (CDC42) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
DLR-CDC42-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cell Division Cycle Protein 42 (CDC42) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
RD-CDC42-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
RD-CDC42-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
RDR-CDC42-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit |
RDR-CDC42-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Anti-CDC42 Rabbit Monoclonal Antibody |
M00119 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal CDC42 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat. |
CDC42 Polyclonal Antibody, HRP Conjugated |
A62235 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CDC42 Polyclonal Antibody, FITC Conjugated |
A62236 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CDC42 Polyclonal Antibody, Biotin Conjugated |
A62237 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CDC42 antibody |
70R-49516 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CDC42 antibody |
CDC42 antibody |
70R-32475 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CDC42 antibody |
CDC42 Antibody |
35353-100ul |
SAB |
100ul |
EUR 390 |
CDC42 Antibody |
49282-100ul |
SAB |
100ul |
EUR 333 |
CDC42 Antibody |
49282-50ul |
SAB |
50ul |
EUR 239 |
CDC42 antibody |
10R-10300 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal CDC42 antibody |
CDC42 antibody |
10R-10301 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal CDC42 antibody |
CDC42 Antibody |
32214-100ul |
SAB |
100ul |
EUR 252 |
CDC42 Antibody |
24863-100ul |
SAB |
100ul |
EUR 390 |
CDC42 antibody |
70R-13909 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal CDC42 antibody |
CDC42 antibody |
70R-10438 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CDC42 antibody |
CDC42 antibody |
70R-16304 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CDC42 antibody |
CDC42 Antibody |
DF6322 |
Affbiotech |
200ul |
EUR 304 |
Description: CDC42 Antibody detects endogenous levels of total CDC42. |
CDC42 Antibody |
DF2308 |
Affbiotech |
200ul |
EUR 304 |
Description: CDC42 antibody detects endogenous levels of total CDC42. |
CDC42 Antibody |
1-CSB-PA005008DA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
CDC42 Antibody |
1-CSB-PA005008GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CDC42 Antibody |
1-CSB-PA620509 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
Rac1/2/3/CDC42 Polyclonal Antibody |
ES3300-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Rac1/2/3/CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Rac1/2/3/CDC42 Polyclonal Antibody |
ES3300-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Rac1/2/3/CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Rac1/2/3/CDC42 Polyclonal Antibody |
ABP52301-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
- Applications tips:
|
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71 |
Rac1/2/3/CDC42 Polyclonal Antibody |
ABP52301-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
- Applications tips:
|
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71 |
Rac1/2/3/CDC42 Polyclonal Antibody |
ABP52301-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
- Applications tips:
|
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71 |
CDC42 Conjugated Antibody |
C49282 |
SAB |
100ul |
EUR 397 |
CDC42 Conjugated Antibody |
C32214 |
SAB |
100ul |
EUR 397 |
Rac1/cdc42 Antibody |
AF7828 |
Affbiotech |
200ul |
EUR 376 |
Description: Rac1/cdc42 Antibody detects endogenous levels of Rac1/cdc42. |
anti- CDC42 antibody |
FNab01530 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: cell division cycle 42 (GTP binding protein, 25kDa)
- Uniprot ID: P60953
- Gene ID: 998
- Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
|
Description: Antibody raised against CDC42 |
Anti-CDC42 Antibody |
A00119 |
BosterBio |
100ug/vial |
EUR 334 |
cdc42/Rac Antibody |
3080-100 |
Biovision |
|
EUR 338 |
cdc42/Rac Antibody |
3080-30T |
Biovision |
|
EUR 146 |
Anti-CDC42 Antibody |
PA1366 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-CDC42 antibody |
STJ29840 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. |
Anti-CDC42 antibody |
STJ191678 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CDC42 |
Anti-Phospho-Rac1/Cdc42 (Ser71) Rabbit Monoclonal Antibody |
P00119 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Phospho-Rac1/Cdc42 (Ser71) Antibody. Validated in WB and tested in Human. |
Anti-Rac1/CDC42 Antibody |
A03252 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Rac1/CDC42 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
CDC42 recombinant monoclonal antibody |
A5689 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human CDC42 for WB, IHC,ELISA |
CDC42/RHO/RAC Antibody |
36743-100ul |
SAB |
100ul |
EUR 252 |
CDC42 Antibody, HRP conjugated |
1-CSB-PA005008DB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CDC42 Antibody, FITC conjugated |
1-CSB-PA005008DC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CDC42 Antibody, Biotin conjugated |
1-CSB-PA005008DD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CDC42 siRNA |
20-abx900943 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC42 siRNA |
20-abx911162 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC42 siRNA |
20-abx911163 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC42 protein |
30R-3026 |
Fitzgerald |
200 ug |
EUR 354 |
Description: Purified recombinant CDC42 protein |
CDC42, Human |
LF-P0143 |
Abfrontier |
0.2 mg |
EUR 303 |
Description: CDC42, Human protein |
anti-CDC42 |
YF-PA10844 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CDC42 |
Polyclonal Cdc42-binding kinase alpha Antibody (N-Term) |
APR15361G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Cdc42-binding kinase alpha (N-Term). This antibody is tested and proven to work in the following applications: |
CDC42 binding protein kinase beta (CDC42BPB) polyclonal antibody |
ABP-PAB-02396 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Kinases
- Brand:
|
Cdc42 G15A Agarose Beads (Active Cdc42-GEF) |
STA-433 |
Cell Biolabs |
800 ?g |
EUR 699 |
Description: Cdc42 G15A Agarose Beads selectively pull down the active form of Cdc42 GEF. Beads are colored to allow for a visual check. 800 µg. |
Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human) |
4-PAE614Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDC42 (Met1~Cys188)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42) |
Rac1/2/3/CDC42 Antibody |
AF9178 |
Affbiotech |
200ul |
EUR 304 |
Description: Rac1/2/3/CDC42 Antibody detects endogenous levels of total Rac1/2/3/CDC42. |
Phospho-Rac1/cdc42 (Ser71) Antibody |
AF2393 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-Rac1/cdc42 (Ser71) Antibody detects endogenous levels of Rac1/cdc42. |
CDC42/RHO/RAC Conjugated Antibody |
C36743 |
SAB |
100ul |
EUR 397 |
Phospho-Rac1/cdc42 (Tyr64) Antibody |
AF7328 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-Rac1/cdc42 (Tyr64) Antibody detects endogenous levels of Rac1/cdc42 only when phosphorylated at Tyr64. |
RAC1 / RAC2 / RAC3 / CDC42 Antibody |
20-abx328546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rac1 / 2 / 3 / CDC42 Antibody |
20-abx218145 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cdc42-binding kinase alpha Antibody |
abx431727-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Rac1/2/3/CDC42 Antibody |
44403-100ul |
SAB |
100ul |
EUR 252 |
Rac1/2/3/CDC42 Antibody |
44403-50ul |
SAB |
50ul |
EUR 187 |
Rac1/cdc42 (Phospho-Tyr64) Antibody |
13177-100ul |
SAB |
100ul |
EUR 252 |
Rac1/cdc42 (Phospho-Tyr64) Antibody |
13177-50ul |
SAB |
50ul |
EUR 187 |
Rac1+Cdc42(Phospho-Ser71) Antibody |
13425-100ul |
SAB |
100ul |
EUR 333 |
Rac1+Cdc42(Phospho-Ser71) Antibody |
13425-50ul |
SAB |
50ul |
EUR 239 |
RAC1/RAC2/RAC3/CDC42 Antibody |
1-CSB-PA003908 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against RAC1/RAC2/RAC3/CDC42. Recognizes RAC1/RAC2/RAC3/CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit |
E04C2465-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit |
E04C2465-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit |
E04C2465-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit |
E04C1515-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit |
E04C1515-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit |
E04C1515-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit |
E04C1516-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit |
E04C1516-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit |
E04C1516-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit |
E04C1517-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit |
E04C1517-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit |
E04C1517-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit |
E04C1518-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit |
E04C1518-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit |
E04C1518-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit |
E04C1519-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit |
E04C1519-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit |
E04C1519-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit |
E04A2011-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit |
E04A2011-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit |
E04A2011-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cdc42 Recombinant Adenovirus |
ADV-152 |
Cell Biolabs |
50 ?L |
EUR 891 |
Description: Premade recombinant adenovirus containing the Cdc42 gene |
CDC42 cloning plasmid |
CSB-CL005008HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 576
- Sequence: atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgc
- Show more
|
Description: A cloning plasmid for the CDC42 gene. |
CDC42 Blocking Peptide |
20-abx062391 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC42 Blocking Peptide |
33R-2092 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC42 antibody, catalog no. 70R-10438 |
CDC42 Rabbit Polyclonal Antibody