CENPL Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CENPL Polyclonal Antibody

ABP58116-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CENPL protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of CENPL from Human. This CENPL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPL protein at amino acid sequence of 100-180

CENPL Polyclonal Antibody

ES10524-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CENPL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CENPL Polyclonal Antibody

ES10524-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CENPL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CENPL antibody

70R-16352 50 ul
EUR 435
Description: Rabbit polyclonal CENPL antibody

CENPL Antibody

44713-100ul 100ul
EUR 252

CENPL Antibody

44713-50ul 50ul
EUR 187

CENPL Antibody

1-CSB-PA005215GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CENPL. Recognizes CENPL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CENPL Antibody

DF2313 200ul
EUR 304
Description: CENPL antibody detects endogenous levels of total CENPL.

CENPL Antibody

ABD2313 100 ug
EUR 438

CENPL Conjugated Antibody

C44713 100ul
EUR 397

anti- CENPL antibody

FNab01588 100µg
EUR 548.75
  • Immunogen: centromere protein L
  • Uniprot ID: Q8N0S6
  • Gene ID: 91687
  • Research Area: Epigenetics
Description: Antibody raised against CENPL

Anti-CENPL antibody

PAab01588 100 ug
EUR 386

Anti-CENPL antibody

STJ191682 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CENPL

CENPL siRNA

20-abx901001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CENPL siRNA

20-abx911459
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CENPL siRNA

20-abx911460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CENPL

YF-PA21717 50 ug
EUR 363
Description: Mouse polyclonal to CENPL

Rabbit Centromere protein L(CENPL) ELISA kit

E04C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein L(CENPL) ELISA kit

E04C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein L(CENPL) ELISA kit

E04C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CENPL Blocking Peptide

DF2313-BP 1mg
EUR 195

CENPL cloning plasmid

CSB-CL005215HU-10ug 10ug
EUR 439
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atggattcttacagtgcaccagagtcaactcctagtgcatcctcaagacctgaagattactttataggtgccactcctctgcagaaacgattagaatcggtcaggaagcagagttcatttatcctgactccacctcgaaggaaaattccccagtgttcgcagttgcaggaagatg
  • Show more
Description: A cloning plasmid for the CENPL gene.

Centromere Protein L (CENPL) Antibody

20-abx111545
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Centromere Protein L (CENPL) Antibody

20-abx148736
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Centromere Protein L (CENPL) Antibody

abx231588-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CENPL ELISA KIT|Human

EF008590 96 Tests
EUR 689

Rat CENPL shRNA Plasmid

20-abx988369
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CENPL shRNA Plasmid

20-abx977219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CENPL shRNA Plasmid

20-abx964066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CENPL Recombinant Protein (Human)

RP006760 100 ug Ask for price

CENPL Recombinant Protein (Rat)

RP194546 100 ug Ask for price

CENPL Recombinant Protein (Rat)

RP194549 100 ug Ask for price

CENPL Recombinant Protein (Mouse)

RP123494 100 ug Ask for price

CENPL Recombinant Protein (Mouse)

RP123497 100 ug Ask for price

Cenpl ORF Vector (Rat) (pORF)

ORF064850 1.0 ug DNA
EUR 506

Cenpl ORF Vector (Rat) (pORF)

ORF064851 1.0 ug DNA
EUR 506

CENPL ORF Vector (Human) (pORF)

ORF002254 1.0 ug DNA
EUR 95

Cenpl ORF Vector (Mouse) (pORF)

ORF041166 1.0 ug DNA
EUR 506

Cenpl ORF Vector (Mouse) (pORF)

ORF041167 1.0 ug DNA
EUR 506

CENPL sgRNA CRISPR Lentivector set (Human)

K0432601 3 x 1.0 ug
EUR 339

Cenpl sgRNA CRISPR Lentivector set (Rat)

K7259301 3 x 1.0 ug
EUR 339

Cenpl sgRNA CRISPR Lentivector set (Mouse)

K4545401 3 x 1.0 ug
EUR 339

Human Centromere protein L(CENPL) ELISA kit

E01C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein L(CENPL) ELISA kit

E01C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein L(CENPL) ELISA kit

E01C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein L(CENPL) ELISA kit

E06C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein L(CENPL) ELISA kit

E06C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein L(CENPL) ELISA kit

E06C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein L(CENPL) ELISA kit

E03C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein L(CENPL) ELISA kit

E03C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein L(CENPL) ELISA kit

E03C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein L(CENPL) ELISA kit

E02C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein L(CENPL) ELISA kit

E02C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein L(CENPL) ELISA kit

E02C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein L(CENPL) ELISA kit

E09C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein L(CENPL) ELISA kit

E09C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein L(CENPL) ELISA kit

E09C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein L(CENPL) ELISA kit

E08C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein L(CENPL) ELISA kit

E08C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein L(CENPL) ELISA kit

E08C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein L(CENPL) ELISA kit

E07C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein L(CENPL) ELISA kit

E07C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein L(CENPL) ELISA kit

E07C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein L, Cenpl ELISA KIT

ELI-25142r 96 Tests
EUR 886

Human Centromere Protein L (CENPL) ELISA Kit

abx386458-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Centromere protein L, Cenpl ELISA KIT

ELI-33858m 96 Tests
EUR 865

Bovine Centromere protein L, CENPL ELISA KIT

ELI-34205b 96 Tests
EUR 928

Human Centromere protein L, CENPL ELISA KIT

ELI-49963h 96 Tests
EUR 824

Chicken Centromere protein L, CENPL ELISA KIT

ELI-50867c 96 Tests
EUR 928

CENPL sgRNA CRISPR Lentivector (Human) (Target 1)

K0432602 1.0 ug DNA
EUR 154

CENPL sgRNA CRISPR Lentivector (Human) (Target 2)

K0432603 1.0 ug DNA
EUR 154

CENPL sgRNA CRISPR Lentivector (Human) (Target 3)

K0432604 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Rat) (Target 1)

K7259302 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Rat) (Target 2)

K7259303 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Rat) (Target 3)

K7259304 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4545402 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4545403 1.0 ug DNA
EUR 154

Cenpl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4545404 1.0 ug DNA
EUR 154

CENPL Protein Vector (Mouse) (pPB-C-His)

PV164662 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPB-N-His)

PV164663 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPM-C-HA)

PV164664 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPM-C-His)

PV164665 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPB-C-His)

PV164666 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPB-N-His)

PV164667 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPM-C-HA)

PV164668 500 ng
EUR 603

CENPL Protein Vector (Mouse) (pPM-C-His)

PV164669 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPB-C-His)

PV259398 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPB-N-His)

PV259399 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPM-C-HA)

PV259400 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPM-C-His)

PV259401 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPB-C-His)

PV259402 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPB-N-His)

PV259403 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPM-C-HA)

PV259404 500 ng
EUR 603

CENPL Protein Vector (Rat) (pPM-C-His)

PV259405 500 ng
EUR 603

CENPL Protein Vector (Human) (pPB-C-His)

PV009013 500 ng
EUR 329

CENPL Protein Vector (Human) (pPB-N-His)

PV009014 500 ng
EUR 329

CENPL Protein Vector (Human) (pPM-C-HA)

PV009015 500 ng
EUR 329

CENPL Protein Vector (Human) (pPM-C-His)

PV009016 500 ng
EUR 329

Cenpl 3'UTR GFP Stable Cell Line

TU153720 1.0 ml Ask for price

Cenpl 3'UTR Luciferase Stable Cell Line

TU103720 1.0 ml Ask for price

Cenpl 3'UTR Luciferase Stable Cell Line

TU202176 1.0 ml Ask for price

Cenpl 3'UTR GFP Stable Cell Line

TU252176 1.0 ml Ask for price

CENPL 3'UTR GFP Stable Cell Line

TU054224 1.0 ml
EUR 1394

CENPL 3'UTR Luciferase Stable Cell Line

TU004224 1.0 ml
EUR 1394

Guinea pig Centromere protein L(CENPL) ELISA kit

E05C0932-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Centromere protein L(CENPL) ELISA kit

E05C0932-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Centromere protein L(CENPL) ELISA kit

E05C0932-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Centromere protein L(CENPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CENPL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669043 1.0 ug DNA
EUR 682

CENPL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669047 1.0 ug DNA
EUR 682

CENPL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669048 1.0 ug DNA
EUR 682

CENPL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669049 1.0 ug DNA
EUR 682

CENPL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669053 1.0 ug DNA
EUR 682

CENPL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669054 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

CENPL Rabbit Polyclonal Antibody