CIRBP Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CIRBP Polyclonal Antibody

ABP58158-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CIRBP protein
  • Applications tips:
Description: A polyclonal antibody for detection of CIRBP from Human, Mouse, Rat. This CIRBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CIRBP protein

CIRBP Rabbit pAb

A6080-100ul 100 ul
EUR 308

CIRBP Rabbit pAb

A6080-200ul 200 ul
EUR 459

CIRBP Rabbit pAb

A6080-20ul 20 ul
EUR 183

CIRBP Rabbit pAb

A6080-50ul 50 ul
EUR 223

CIRBP Rabbit pAb

A6559-100ul 100 ul
EUR 308

CIRBP Rabbit pAb

A6559-200ul 200 ul
EUR 459

CIRBP Rabbit pAb

A6559-20ul 20 ul
EUR 183

CIRBP Rabbit pAb

A6559-50ul 50 ul
EUR 223

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit

RD-CIRBP-Hu-48Tests 48 Tests
EUR 521

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit

RD-CIRBP-Hu-96Tests 96 Tests
EUR 723

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit

RDR-CIRBP-Hu-48Tests 48 Tests
EUR 544

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit

RDR-CIRBP-Hu-96Tests 96 Tests
EUR 756

Rat CIRBP(CIRBP)

QY-E11680 96T
EUR 374

Polyclonal CIRBP Antibody (C-term)

APR06147G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications:

CIRBP antibody

70R-5012 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP

CIRBP antibody

70R-4931 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP

CIRBP Antibody

ABD2643 100 ug
EUR 438

CIRBP antibody

39007-100ul 100ul
EUR 252

CIRBP Antibody

46954-100ul 100ul
EUR 252

CIRBP antibody

70R-16426 50 ul
EUR 435
Description: Rabbit polyclonal CIRBP antibody

CIRBP Antibody

DF2643 200ul
EUR 304
Description: CIRBP antibody detects endogenous levels of total CIRBP.

CIRBP Antibody

1-CSB-PA005440GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CIRBP Antibody

1-CSB-PA613483DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal CIRP / CIRBP Antibody (aa161-172)

APG01188G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications:

CIRBP Conjugated Antibody

C39007 100ul
EUR 397

anti- CIRBP antibody

FNab01715 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:10 - 1:100
  • Immunogen: cold inducible RNA binding protein
  • Uniprot ID: Q14011
  • Gene ID: 1153
  • Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CIRBP

CIRBP Antibody (Biotin)

abx431162-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-CIRBP antibody

PAab01715 100 ug
EUR 386

Anti-CIRBP antibody

STJ28642 100 µl
EUR 277

Anti-CIRBP antibody

STJ113565 100 µl
EUR 277

Anti-CIRBP antibody

STJ191955 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CIRBP

CIRBP siRNA

20-abx901080
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CIRBP siRNA

20-abx911879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CIRBP siRNA

20-abx911880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CIRBP

YF-PA10960 100 ug
EUR 403
Description: Rabbit polyclonal to CIRBP

Polyclonal CIRBP (aa 81-91) Antibody (internal region)

APG00688G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal CIRBP (aa 161-172) Antibody (C-Term)

APG00689G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications:

CIRBP cloning plasmid

CSB-CL613483HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.

CIRBP cloning plasmid

CSB-CL613483HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.

CIRBP Blocking Peptide

33R-3676 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931

CIRBP Blocking Peptide

33R-5739 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012

CIRBP Blocking Peptide

DF2643-BP 1mg
EUR 195

pCMV-SPORT6-CIRBP

PVT12397 2 ug
EUR 391

Anti-CIRBP (1C9)

YF-MA12456 100 ug
EUR 363
Description: Mouse monoclonal to CIRBP

Anti-CIRBP (aa 81-91) antibody

STJ72321 100 µg
EUR 359

Anti-CIRBP (aa 161-172) antibody

STJ72322 100 µg
EUR 359

Rat CIRBP shRNA Plasmid

20-abx986740
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CIRBP ELISA Kit

ELA-E12931h 96 Tests
EUR 824

CIRBP ELISA KIT|Human

EF005111 96 Tests
EUR 689

Human CIRBP shRNA Plasmid

20-abx950827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CIRBP protein (His tag)

80R-1790 100 ug
EUR 305
Description: Purified recombinant Human CIRBP protein

Mouse CIRBP shRNA Plasmid

20-abx969680
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CIRBP Recombinant Protein (Human)

RP007156 100 ug Ask for price

CIRBP Recombinant Protein (Human)

RP007159 100 ug Ask for price

pECMV-3-FLAG-CIRBP

PVT12996 2 ug
EUR 325

CIRBP Recombinant Protein (Rat)

RP195086 100 ug Ask for price

CIRBP Recombinant Protein (Mouse)

RP124229 100 ug Ask for price

Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit

E04C1731-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit

E04C1731-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit

E04C1731-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig)

4-PAG886Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP)

Cold Inducible RNA Binding Protein (CIRBP) Antibody

20-abx128874
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

20-abx002739
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx147827-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx034242-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx034242-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

20-abx005033
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

20-abx321706
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx224360-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx431161-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx431163-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

20-abx225110
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cold-Inducible RNA-Binding Protein (CIRBP) Antibody

abx231715-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Cold Inducible RNA Binding Protein (CIRBP) Antibody

20-abx171828
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-CIRBP (aa 161-172), Biotinylated antibody

STJ73183 100 µg
EUR 359

CIRBP ORF Vector (Human) (pORF)

ORF002386 1.0 ug DNA
EUR 95

CIRBP ORF Vector (Human) (pORF)

ORF002387 1.0 ug DNA
EUR 95

Cirbp ORF Vector (Rat) (pORF)

ORF065030 1.0 ug DNA
EUR 506

Cirbp ORF Vector (Mouse) (pORF)

ORF041411 1.0 ug DNA
EUR 506

CIRBP ELISA Kit (Mouse) (OKCA02356)

OKCA02356 96 Wells
EUR 846
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Promotes assembly of stress granules (SGs), when overexpressed. Seems to play an essential role in cold-induced suppression of cell proliferation. Acts as a translational repressor. Acts as a translational activator. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL

CIRBP ELISA Kit (Human) (OKCD08989)

OKCD08989 96 Wells
EUR 975
Description: Description of target: CIRBP contains 1 RRM (RNA recognition motif) domain. It seems to play an essential role in cold-induced suppression of cell proliferation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 35pg/mL

CIRBP ELISA Kit (Rat) (OKEH03626)

OKEH03626 96 Wells
EUR 779
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Acts as a translational activator. Seems to play an essential role in cold-induced suppression of cell proliferation. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN. Acts as a translational repressor. Promotes assembly of stress granules (SGs), when overexpressed.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.3 pg/mL

CIRBP ELISA Kit (Mouse) (OKEH05575)

OKEH05575 96 Wells
EUR 779
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Promotes assembly of stress granules (SGs), when overexpressed. Seems to play an essential role in cold-induced suppression of cell proliferation. Acts as a translational repressor. Acts as a translational activator. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), APC

4-PAG886Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with APC.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

4-PAG886Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with Biotin.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), Cy3

4-PAG886Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with Cy3.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), FITC

4-PAG886Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with FITC.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), HRP

4-PAG886Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with HRP.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), PE

4-PAG886Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with PE.

Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

4-PAG886Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CIRBP (Met1~Glu172)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with APC-Cy7.

CIRBP sgRNA CRISPR Lentivector set (Human)

K0454001 3 x 1.0 ug
EUR 339

Cirbp sgRNA CRISPR Lentivector set (Mouse)

K4590801 3 x 1.0 ug
EUR 339

Cirbp sgRNA CRISPR Lentivector set (Rat)

K7072301 3 x 1.0 ug
EUR 339

CIRBP-AS1 ORF Vector (Human) (pORF)

ORF017411 1.0 ug DNA Ask for price

Active Cold Inducible RNA Binding Protein (CIRBP)

4-APG886Hu01
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • EUR 996.00
  • EUR 1892.00
  • EUR 610.00
  • EUR 6820.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14011
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.7kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Cold Inducible RNA Binding Protein expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Active Cold Inducible RNA Binding Protein (CIRBP)

4-APG886Mu01
  • EUR 699.42
  • EUR 290.00
  • EUR 2347.84
  • EUR 849.28
  • EUR 1598.56
  • EUR 531.00
  • EUR 5719.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 9.6
Description: Recombinant Mouse Cold Inducible RNA Binding Protein expressed in: E.coli

CIRBP sgRNA CRISPR Lentivector (Human) (Target 1)

K0454002 1.0 ug DNA
EUR 154

CIRBP sgRNA CRISPR Lentivector (Human) (Target 2)

K0454003 1.0 ug DNA
EUR 154

CIRBP sgRNA CRISPR Lentivector (Human) (Target 3)

K0454004 1.0 ug DNA
EUR 154

Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4590802 1.0 ug DNA
EUR 154

Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4590803 1.0 ug DNA
EUR 154

Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4590804 1.0 ug DNA
EUR 154

Mouse Cold-inducible RNA-binding protein (Cirbp)

1-CSB-EP005440MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Cold-inducible RNA-binding protein(Cirbp) expressed in E.coli

Human Cold-inducible RNA-binding protein (CIRBP)

1-CSB-EP613483HUe0
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cold-inducible RNA-binding protein(CIRBP) expressed in E.coli

Cirbp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7072302 1.0 ug DNA
EUR 154

Cirbp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7072303 1.0 ug DNA
EUR 154

Cirbp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7072304 1.0 ug DNA
EUR 154

Recombinant Cold Inducible RNA Binding Protein (CIRBP)

4-RPG886Hu01
  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14011
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.5kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Cold Inducible RNA Binding Protein expressed in: E.coli

Recombinant Cold Inducible RNA Binding Protein (CIRBP)

4-RPG886Mu01
  • EUR 516.64
  • EUR 241.00
  • EUR 1662.40
  • EUR 620.80
  • EUR 1141.60
  • EUR 409.00
  • EUR 4006.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 9.6
Description: Recombinant Mouse Cold Inducible RNA Binding Protein expressed in: Prokaryotic expression

CIRBP Protein Vector (Human) (pPB-C-His)

PV009541 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPB-N-His)

PV009542 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPM-C-HA)

PV009543 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPM-C-His)

PV009544 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPB-C-His)

PV009545 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPB-N-His)

PV009546 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPM-C-HA)

PV009547 500 ng
EUR 329

CIRBP Protein Vector (Human) (pPM-C-His)

PV009548 500 ng
EUR 329

CIRBP Protein Vector (Rat) (pPB-C-His)

PV260118 500 ng
EUR 603

CIRBP Protein Vector (Rat) (pPB-N-His)

PV260119 500 ng
EUR 603

CIRBP Protein Vector (Rat) (pPM-C-HA)

PV260120 500 ng
EUR 603

CIRBP Protein Vector (Rat) (pPM-C-His)

PV260121 500 ng
EUR 603

CIRBP Protein Vector (Mouse) (pPB-C-His)

PV165642 500 ng
EUR 603

CIRBP Protein Vector (Mouse) (pPB-N-His)

PV165643 500 ng
EUR 603

CIRBP Protein Vector (Mouse) (pPM-C-HA)

PV165644 500 ng
EUR 603

CIRBP Protein Vector (Mouse) (pPM-C-His)

PV165645 500 ng
EUR 603

Cirbp 3'UTR Luciferase Stable Cell Line

TU202369 1.0 ml Ask for price

Cirbp 3'UTR GFP Stable Cell Line

TU153917 1.0 ml Ask for price

CIRBP 3'UTR Luciferase Stable Cell Line

TU004464 1.0 ml
EUR 1394

Cirbp 3'UTR Luciferase Stable Cell Line

TU103917 1.0 ml Ask for price

CIRBP 3'UTR GFP Stable Cell Line

TU054464 1.0 ml
EUR 1394

Cirbp 3'UTR GFP Stable Cell Line

TU252369 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CIRBP Rabbit Polyclonal Antibody