CIRBP Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CIRBP Polyclonal Antibody |
ABP58158-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CIRBP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CIRBP from Human, Mouse, Rat. This CIRBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CIRBP protein |
CIRBP Rabbit pAb |
A6080-100ul |
Abclonal |
100 ul |
EUR 308 |
CIRBP Rabbit pAb |
A6080-200ul |
Abclonal |
200 ul |
EUR 459 |
CIRBP Rabbit pAb |
A6080-20ul |
Abclonal |
20 ul |
EUR 183 |
CIRBP Rabbit pAb |
A6080-50ul |
Abclonal |
50 ul |
EUR 223 |
CIRBP Rabbit pAb |
A6559-100ul |
Abclonal |
100 ul |
EUR 308 |
CIRBP Rabbit pAb |
A6559-200ul |
Abclonal |
200 ul |
EUR 459 |
CIRBP Rabbit pAb |
A6559-20ul |
Abclonal |
20 ul |
EUR 183 |
CIRBP Rabbit pAb |
A6559-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit |
RD-CIRBP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit |
RD-CIRBP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit |
RDR-CIRBP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit |
RDR-CIRBP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Polyclonal CIRBP Antibody (C-term) |
APR06147G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications: |
CIRBP antibody |
70R-5012 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP |
CIRBP antibody |
70R-4931 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP |
CIRBP antibody |
39007-100ul |
SAB |
100ul |
EUR 252 |
CIRBP Antibody |
46954-100ul |
SAB |
100ul |
EUR 252 |
CIRBP antibody |
70R-16426 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CIRBP antibody |
CIRBP Antibody |
DF2643 |
Affbiotech |
200ul |
EUR 304 |
Description: CIRBP antibody detects endogenous levels of total CIRBP. |
CIRBP Antibody |
1-CSB-PA005440GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CIRBP Antibody |
1-CSB-PA613483DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Polyclonal CIRP / CIRBP Antibody (aa161-172) |
APG01188G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications: |
CIRBP Conjugated Antibody |
C39007 |
SAB |
100ul |
EUR 397 |
anti- CIRBP antibody |
FNab01715 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- IF: 1:10 - 1:100
- Immunogen: cold inducible RNA binding protein
- Uniprot ID: Q14011
- Gene ID: 1153
- Research Area: Cell Division and Proliferation, Metabolism
|
Description: Antibody raised against CIRBP |
CIRBP Antibody (Biotin) |
abx431162-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Anti-CIRBP antibody |
STJ191955 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CIRBP |
CIRBP siRNA |
20-abx901080 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CIRBP siRNA |
20-abx911879 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CIRBP siRNA |
20-abx911880 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CIRBP |
YF-PA10960 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CIRBP |
Polyclonal CIRBP (aa 81-91) Antibody (internal region) |
APG00688G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal CIRBP (aa 161-172) Antibody (C-Term) |
APG00689G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications: |
CIRBP cloning plasmid |
CSB-CL613483HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
- Show more
|
Description: A cloning plasmid for the CIRBP gene. |
CIRBP cloning plasmid |
CSB-CL613483HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
- Show more
|
Description: A cloning plasmid for the CIRBP gene. |
CIRBP Blocking Peptide |
33R-3676 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931 |
CIRBP Blocking Peptide |
33R-5739 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012 |
CIRBP Blocking Peptide |
DF2643-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-CIRBP (1C9) |
YF-MA12456 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CIRBP |
Rat CIRBP shRNA Plasmid |
20-abx986740 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CIRBP shRNA Plasmid |
20-abx950827 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CIRBP protein (His tag) |
80R-1790 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human CIRBP protein |
Mouse CIRBP shRNA Plasmid |
20-abx969680 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CIRBP Recombinant Protein (Human) |
RP007156 |
ABM |
100 ug |
Ask for price |
CIRBP Recombinant Protein (Human) |
RP007159 |
ABM |
100 ug |
Ask for price |
CIRBP Recombinant Protein (Rat) |
RP195086 |
ABM |
100 ug |
Ask for price |
CIRBP Recombinant Protein (Mouse) |
RP124229 |
ABM |
100 ug |
Ask for price |
Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit |
E04C1731-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit |
E04C1731-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cold inducible RNA binding protein(CIRBP) ELISA kit |
E04C1731-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cold inducible RNA binding protein(CIRBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig) |
4-PAG886Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP) |
Cold Inducible RNA Binding Protein (CIRBP) Antibody |
20-abx128874 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
20-abx002739 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx147827-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx034242-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx034242-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
20-abx005033 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
20-abx321706 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx224360-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx431161-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx431163-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
20-abx225110 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Cold-Inducible RNA-Binding Protein (CIRBP) Antibody |
abx231715-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Cold Inducible RNA Binding Protein (CIRBP) Antibody |
20-abx171828 |
Abbexa |
|
|
|
CIRBP ORF Vector (Human) (pORF) |
ORF002386 |
ABM |
1.0 ug DNA |
EUR 95 |
CIRBP ORF Vector (Human) (pORF) |
ORF002387 |
ABM |
1.0 ug DNA |
EUR 95 |
Cirbp ORF Vector (Rat) (pORF) |
ORF065030 |
ABM |
1.0 ug DNA |
EUR 506 |
Cirbp ORF Vector (Mouse) (pORF) |
ORF041411 |
ABM |
1.0 ug DNA |
EUR 506 |
CIRBP ELISA Kit (Mouse) (OKCA02356) |
OKCA02356 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Promotes assembly of stress granules (SGs), when overexpressed. Seems to play an essential role in cold-induced suppression of cell proliferation. Acts as a translational repressor. Acts as a translational activator. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL |
CIRBP ELISA Kit (Human) (OKCD08989) |
OKCD08989 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: CIRBP contains 1 RRM (RNA recognition motif) domain. It seems to play an essential role in cold-induced suppression of cell proliferation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 35pg/mL |
CIRBP ELISA Kit (Rat) (OKEH03626) |
OKEH03626 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Acts as a translational activator. Seems to play an essential role in cold-induced suppression of cell proliferation. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN. Acts as a translational repressor. Promotes assembly of stress granules (SGs), when overexpressed.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.3 pg/mL |
CIRBP ELISA Kit (Mouse) (OKEH05575) |
OKEH05575 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Promotes assembly of stress granules (SGs), when overexpressed. Seems to play an essential role in cold-induced suppression of cell proliferation. Acts as a translational repressor. Acts as a translational activator. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), APC |
4-PAG886Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with APC. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated |
4-PAG886Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with Biotin. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), Cy3 |
4-PAG886Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with Cy3. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), FITC |
4-PAG886Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with FITC. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), HRP |
4-PAG886Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with HRP. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), PE |
4-PAG886Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with PE. |
Cold Inducible RNA Binding Protein (CIRBP) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7 |
4-PAG886Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CIRBP (Met1~Glu172)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Cold Inducible RNA Binding Protein (CIRBP). This antibody is labeled with APC-Cy7. |
CIRBP sgRNA CRISPR Lentivector set (Human) |
K0454001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cirbp sgRNA CRISPR Lentivector set (Mouse) |
K4590801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cirbp sgRNA CRISPR Lentivector set (Rat) |
K7072301 |
ABM |
3 x 1.0 ug |
EUR 339 |
CIRBP-AS1 ORF Vector (Human) (pORF) |
ORF017411 |
ABM |
1.0 ug DNA |
Ask for price |
Active Cold Inducible RNA Binding Protein (CIRBP) |
4-APG886Hu01 |
Cloud-Clone |
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
-
EUR 996.00
-
EUR 1892.00
-
EUR 610.00
-
EUR 6820.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14011
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.7kDa
- Isoelectric Point: 9.7
|
Description: Recombinant Human Cold Inducible RNA Binding Protein expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Active Cold Inducible RNA Binding Protein (CIRBP) |
4-APG886Mu01 |
Cloud-Clone |
-
EUR 699.42
-
EUR 290.00
-
EUR 2347.84
-
EUR 849.28
-
EUR 1598.56
-
EUR 531.00
-
EUR 5719.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.3kDa
- Isoelectric Point: 9.6
|
Description: Recombinant Mouse Cold Inducible RNA Binding Protein expressed in: E.coli |
CIRBP sgRNA CRISPR Lentivector (Human) (Target 1) |
K0454002 |
ABM |
1.0 ug DNA |
EUR 154 |
CIRBP sgRNA CRISPR Lentivector (Human) (Target 2) |
K0454003 |
ABM |
1.0 ug DNA |
EUR 154 |
CIRBP sgRNA CRISPR Lentivector (Human) (Target 3) |
K0454004 |
ABM |
1.0 ug DNA |
EUR 154 |
Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4590802 |
ABM |
1.0 ug DNA |
EUR 154 |
Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4590803 |
ABM |
1.0 ug DNA |
EUR 154 |
Cirbp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4590804 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse Cold-inducible RNA-binding protein (Cirbp) |
1-CSB-EP005440MO |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 22.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Cold-inducible RNA-binding protein(Cirbp) expressed in E.coli |
Human Cold-inducible RNA-binding protein (CIRBP) |
1-CSB-EP613483HUe0 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 45.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Cold-inducible RNA-binding protein(CIRBP) expressed in E.coli |
Cirbp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7072302 |
ABM |
1.0 ug DNA |
EUR 154 |
Cirbp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7072303 |
ABM |
1.0 ug DNA |
EUR 154 |
Cirbp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7072304 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Cold Inducible RNA Binding Protein (CIRBP) |
4-RPG886Hu01 |
Cloud-Clone |
-
EUR 499.62
-
EUR 236.00
-
EUR 1598.56
-
EUR 599.52
-
EUR 1099.04
-
EUR 397.00
-
EUR 3846.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14011
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.5kDa
- Isoelectric Point: 9.7
|
Description: Recombinant Human Cold Inducible RNA Binding Protein expressed in: E.coli |
Recombinant Cold Inducible RNA Binding Protein (CIRBP) |
4-RPG886Mu01 |
Cloud-Clone |
-
EUR 516.64
-
EUR 241.00
-
EUR 1662.40
-
EUR 620.80
-
EUR 1141.60
-
EUR 409.00
-
EUR 4006.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.3kDa
- Isoelectric Point: 9.6
|
Description: Recombinant Mouse Cold Inducible RNA Binding Protein expressed in: Prokaryotic expression |
CIRBP Protein Vector (Human) (pPB-C-His) |
PV009541 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPB-N-His) |
PV009542 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPM-C-HA) |
PV009543 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPM-C-His) |
PV009544 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPB-C-His) |
PV009545 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPB-N-His) |
PV009546 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPM-C-HA) |
PV009547 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Human) (pPM-C-His) |
PV009548 |
ABM |
500 ng |
EUR 329 |
CIRBP Protein Vector (Rat) (pPB-C-His) |
PV260118 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Rat) (pPB-N-His) |
PV260119 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Rat) (pPM-C-HA) |
PV260120 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Rat) (pPM-C-His) |
PV260121 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Mouse) (pPB-C-His) |
PV165642 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Mouse) (pPB-N-His) |
PV165643 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Mouse) (pPM-C-HA) |
PV165644 |
ABM |
500 ng |
EUR 603 |
CIRBP Protein Vector (Mouse) (pPM-C-His) |
PV165645 |
ABM |
500 ng |
EUR 603 |
Cirbp 3'UTR Luciferase Stable Cell Line |
TU202369 |
ABM |
1.0 ml |
Ask for price |
Cirbp 3'UTR GFP Stable Cell Line |
TU153917 |
ABM |
1.0 ml |
Ask for price |
CIRBP 3'UTR Luciferase Stable Cell Line |
TU004464 |
ABM |
1.0 ml |
EUR 1394 |
Cirbp 3'UTR Luciferase Stable Cell Line |
TU103917 |
ABM |
1.0 ml |
Ask for price |
CIRBP 3'UTR GFP Stable Cell Line |
TU054464 |
ABM |
1.0 ml |
EUR 1394 |
Cirbp 3'UTR GFP Stable Cell Line |
TU252369 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CIRBP Rabbit Polyclonal Antibody