CLK3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CLK3 Polyclonal Antibody |
ABP58190-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein |
CLK3 Polyclonal Antibody |
ABP58190-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein |
CLK3 Polyclonal Antibody |
ABP58190-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein |
CLK3 Antibody |
44883-100ul |
SAB |
100ul |
EUR 252 |
CLK3 Antibody |
44883-50ul |
SAB |
50ul |
EUR 187 |
CLK3 Antibody |
DF2662 |
Affbiotech |
200ul |
EUR 304 |
Description: CLK3 antibody detects endogenous levels of total CLK3. |
Dual Specificity Protein Kinase CLK3 (CLK3) Antibody |
abx145545-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dual Specificity Protein Kinase CLK3 (CLK3) Antibody |
20-abx147511 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Protein Kinase CLK3 (Clk3) Antibody |
abx028442-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dual Specificity Protein Kinase CLK3 (Clk3) Antibody |
abx028442-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
CLK3 Conjugated Antibody |
C44883 |
SAB |
100ul |
EUR 397 |
Anti-CLK3 antibody |
STJ191969 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CLK3 |
CLK3 siRNA |
20-abx901115 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLK3 siRNA |
20-abx912091 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLK3 siRNA |
20-abx912092 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CLK3 |
YF-PA10988 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CLK3 |
anti-CLK3 |
YF-PA10989 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CLK3 |
anti-CLK3 |
YF-PA23473 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to CLK3 |
CLK3 cloning plasmid |
CSB-CL005560HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1473
- Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
- Show more
|
Description: A cloning plasmid for the CLK3 gene. |
CLK3 cloning plasmid |
CSB-CL005560HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1473
- Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
- Show more
|
Description: A cloning plasmid for the CLK3 gene. |
CLK3 cloning plasmid |
CSB-CL005560HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1404
- Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
- Show more
|
Description: A cloning plasmid for the CLK3 gene. |
CLK3 Blocking Peptide |
DF2662-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-CLK3 (3C11) |
YF-MA12477 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Anti-CLK3 (7D6) |
YF-MA12478 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Anti-CLK3 (1H2) |
YF-MA10170 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Anti-CLK3 (5B2) |
YF-MA10171 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Anti-CLK3 (1F10) |
YF-MA10172 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Anti-CLK3 (7D6) |
YF-MA10173 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to CLK3 |
Bovine Dual specificity protein kinase CLK3, CLK3 ELISA KIT |
ELI-10191b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Dual specificity protein kinase CLK3, CLK3 ELISA KIT |
ELI-33821h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Dual specificity protein kinase CLK3, Clk3 ELISA KIT |
ELI-46810m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit |
abx384721-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit |
abx388886-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit |
abx391137-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Clk3 ELISA Kit| Rat Dual specificity protein kinase CLK3 ELISA |
EF018490 |
Lifescience Market |
96 Tests |
EUR 689 |
Clk3 ELISA Kit| Mouse Dual specificity protein kinase CLK3 ELIS |
EF014511 |
Lifescience Market |
96 Tests |
EUR 689 |
CLK3 ELISA Kit| Bovine Dual specificity protein kinase CLK3 ELI |
EF011240 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse CLK3 shRNA Plasmid |
20-abx979540 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat CLK3 shRNA Plasmid |
20-abx987732 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CLK3 shRNA Plasmid |
20-abx950856 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal CLK3 Antibody (monoclonal) (M04), Clone: 5B2 |
AMM03396G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5B2. This antibody is applicable in WB, IHC and IF |
Monoclonal CLK3 Antibody (monoclonal) (M05), Clone: 1F10 |
AMM03397G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB, IHC and IF |
Monoclonal CLK3 Antibody (monoclonal) (M07), Clone: 7D6 |
AMM03398G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 7D6. This antibody is applicable in WB, IHC and IF |
CLK3 ORF Vector (Human) (pORF) |
ORF002456 |
ABM |
1.0 ug DNA |
EUR 95 |
CLK3 ORF Vector (Human) (pORF) |
ORF002457 |
ABM |
1.0 ug DNA |
EUR 95 |
CLK3 ORF Vector (Human) (pORF) |
ORF002458 |
ABM |
1.0 ug DNA |
EUR 95 |
Clk3 ORF Vector (Rat) (pORF) |
ORF065132 |
ABM |
1.0 ug DNA |
EUR 506 |
h CLK3 inducible lentiviral particles |
LVP091 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, CLK3, is fully sequence verified and matched to NCBI accession ID: NM_003992.4 |
Clk3 ORF Vector (Mouse) (pORF) |
ORF041580 |
ABM |
1.0 ug DNA |
EUR 506 |
CLK3 sgRNA CRISPR Lentivector set (Human) |
K0466101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Clk3 sgRNA CRISPR Lentivector set (Mouse) |
K4962601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Clk3 sgRNA CRISPR Lentivector set (Rat) |
K6984301 |
ABM |
3 x 1.0 ug |
EUR 339 |
CLK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0466102 |
ABM |
1.0 ug DNA |
EUR 154 |
CLK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0466103 |
ABM |
1.0 ug DNA |
EUR 154 |
CLK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0466104 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4962602 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4962603 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4962604 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6984302 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6984303 |
ABM |
1.0 ug DNA |
EUR 154 |
Clk3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6984304 |
ABM |
1.0 ug DNA |
EUR 154 |
CLK3 Protein Vector (Mouse) (pPB-C-His) |
PV166318 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Mouse) (pPB-N-His) |
PV166319 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Mouse) (pPM-C-HA) |
PV166320 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Mouse) (pPM-C-His) |
PV166321 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Human) (pPB-C-His) |
PV009821 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPB-N-His) |
PV009822 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-HA) |
PV009823 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-His) |
PV009824 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPB-C-His) |
PV009825 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPB-N-His) |
PV009826 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-HA) |
PV009827 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-His) |
PV009828 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPB-C-His) |
PV009829 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPB-N-His) |
PV009830 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-HA) |
PV009831 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Human) (pPM-C-His) |
PV009832 |
ABM |
500 ng |
EUR 329 |
CLK3 Protein Vector (Rat) (pPB-C-His) |
PV260526 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Rat) (pPB-N-His) |
PV260527 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Rat) (pPM-C-HA) |
PV260528 |
ABM |
500 ng |
EUR 603 |
CLK3 Protein Vector (Rat) (pPM-C-His) |
PV260529 |
ABM |
500 ng |
EUR 603 |
Clk3 3'UTR Luciferase Stable Cell Line |
TU202478 |
ABM |
1.0 ml |
Ask for price |
Clk3 3'UTR GFP Stable Cell Line |
TU154030 |
ABM |
1.0 ml |
Ask for price |
CLK3 3'UTR Luciferase Stable Cell Line |
TU004592 |
ABM |
1.0 ml |
EUR 1394 |
Clk3 3'UTR Luciferase Stable Cell Line |
TU104030 |
ABM |
1.0 ml |
Ask for price |
CLK3 3'UTR GFP Stable Cell Line |
TU054592 |
ABM |
1.0 ml |
EUR 1394 |
Clk3 3'UTR GFP Stable Cell Line |
TU252478 |
ABM |
1.0 ml |
Ask for price |
CLK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV661057 |
ABM |
1.0 ug DNA |
EUR 682 |
CLK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV661061 |
ABM |
1.0 ug DNA |
EUR 682 |
CLK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV661062 |
ABM |
1.0 ug DNA |
EUR 682 |
CLK3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV708795 |
ABM |
1.0 ug DNA |
EUR 316 |
CLK3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV708799 |
ABM |
1.0 ug DNA |
EUR 316 |
CLK3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV708800 |
ABM |
1.0 ug DNA |
EUR 316 |
CLK3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV708801 |
ABM |
1.0 ug DNA |
EUR 316 |
CLK3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV708805 |
ABM |
1.0 ug DNA |
EUR 316 |
CLK3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV708806 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
CLK3 Rabbit Polyclonal Antibody