CLK3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CLK3 Polyclonal Antibody

ABP58190-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Polyclonal Antibody

ABP58190-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Polyclonal Antibody

ABP58190-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Antibody

ABD2662 100 ug
EUR 438

CLK3 Antibody

44883-100ul 100ul
EUR 252

CLK3 Antibody

44883-50ul 50ul
EUR 187

CLK3 Antibody

DF2662 200ul
EUR 304
Description: CLK3 antibody detects endogenous levels of total CLK3.

Dual Specificity Protein Kinase CLK3 (CLK3) Antibody

abx145545-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (CLK3) Antibody

20-abx147511
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (Clk3) Antibody

abx028442-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (Clk3) Antibody

abx028442-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Clk3/ Rat Clk3 ELISA Kit

ELI-10192r 96 Tests
EUR 886

CLK3 Conjugated Antibody

C44883 100ul
EUR 397

Anti-CLK3 antibody

STJ191969 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CLK3

CLK3 siRNA

20-abx901115
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLK3 siRNA

20-abx912091
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLK3 siRNA

20-abx912092
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CLK3

YF-PA10988 50 ul
EUR 363
Description: Mouse polyclonal to CLK3

anti-CLK3

YF-PA10989 50 ug
EUR 363
Description: Mouse polyclonal to CLK3

anti-CLK3

YF-PA23473 50 ul
EUR 334
Description: Mouse polyclonal to CLK3

CLK3 cloning plasmid

CSB-CL005560HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 cloning plasmid

CSB-CL005560HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 cloning plasmid

CSB-CL005560HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 Blocking Peptide

DF2662-BP 1mg
EUR 195

Anti-CLK3 (3C11)

YF-MA12477 200 ul
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (7D6)

YF-MA12478 200 ul
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (1H2)

YF-MA10170 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (5B2)

YF-MA10171 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (1F10)

YF-MA10172 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (7D6)

YF-MA10173 50 ug
EUR 363
Description: Mouse monoclonal to CLK3

Bovine Dual specificity protein kinase CLK3, CLK3 ELISA KIT

ELI-10191b 96 Tests
EUR 928

Human Dual specificity protein kinase CLK3, CLK3 ELISA KIT

ELI-33821h 96 Tests
EUR 824

Mouse Dual specificity protein kinase CLK3, Clk3 ELISA KIT

ELI-46810m 96 Tests
EUR 865

Human Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx384721-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx388886-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx391137-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Clk3 ELISA Kit| Rat Dual specificity protein kinase CLK3 ELISA

EF018490 96 Tests
EUR 689

Clk3 ELISA Kit| Mouse Dual specificity protein kinase CLK3 ELIS

EF014511 96 Tests
EUR 689

CLK3 ELISA Kit| Bovine Dual specificity protein kinase CLK3 ELI

EF011240 96 Tests
EUR 689

Mouse CLK3 shRNA Plasmid

20-abx979540
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CLK3 shRNA Plasmid

20-abx987732
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLK3 ELISA KIT|Human

EF004772 96 Tests
EUR 689

Human CLK3 shRNA Plasmid

20-abx950856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-CLK3 Plasmid

PVT16300 2 ug
EUR 325

Monoclonal CLK3 Antibody (monoclonal) (M04), Clone: 5B2

AMM03396G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5B2. This antibody is applicable in WB, IHC and IF

Monoclonal CLK3 Antibody (monoclonal) (M05), Clone: 1F10

AMM03397G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB, IHC and IF

Monoclonal CLK3 Antibody (monoclonal) (M07), Clone: 7D6

AMM03398G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 7D6. This antibody is applicable in WB, IHC and IF

CLK3 ORF Vector (Human) (pORF)

ORF002456 1.0 ug DNA
EUR 95

CLK3 ORF Vector (Human) (pORF)

ORF002457 1.0 ug DNA
EUR 95

CLK3 ORF Vector (Human) (pORF)

ORF002458 1.0 ug DNA
EUR 95

Clk3 ORF Vector (Rat) (pORF)

ORF065132 1.0 ug DNA
EUR 506

h CLK3 inducible lentiviral particles

LVP091 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, CLK3, is fully sequence verified and matched to NCBI accession ID: NM_003992.4

Clk3 ORF Vector (Mouse) (pORF)

ORF041580 1.0 ug DNA
EUR 506

CLK3 sgRNA CRISPR Lentivector set (Human)

K0466101 3 x 1.0 ug
EUR 339

Clk3 sgRNA CRISPR Lentivector set (Mouse)

K4962601 3 x 1.0 ug
EUR 339

Clk3 sgRNA CRISPR Lentivector set (Rat)

K6984301 3 x 1.0 ug
EUR 339

CLK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0466102 1.0 ug DNA
EUR 154

CLK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0466103 1.0 ug DNA
EUR 154

CLK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0466104 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4962602 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4962603 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4962604 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6984302 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6984303 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6984304 1.0 ug DNA
EUR 154

CLK3 Protein Vector (Mouse) (pPB-C-His)

PV166318 500 ng
EUR 603

CLK3 Protein Vector (Mouse) (pPB-N-His)

PV166319 500 ng
EUR 603

CLK3 Protein Vector (Mouse) (pPM-C-HA)

PV166320 500 ng
EUR 603

CLK3 Protein Vector (Mouse) (pPM-C-His)

PV166321 500 ng
EUR 603

CLK3 Protein Vector (Human) (pPB-C-His)

PV009821 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPB-N-His)

PV009822 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-HA)

PV009823 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-His)

PV009824 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPB-C-His)

PV009825 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPB-N-His)

PV009826 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-HA)

PV009827 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-His)

PV009828 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPB-C-His)

PV009829 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPB-N-His)

PV009830 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-HA)

PV009831 500 ng
EUR 329

CLK3 Protein Vector (Human) (pPM-C-His)

PV009832 500 ng
EUR 329

CLK3 Protein Vector (Rat) (pPB-C-His)

PV260526 500 ng
EUR 603

CLK3 Protein Vector (Rat) (pPB-N-His)

PV260527 500 ng
EUR 603

CLK3 Protein Vector (Rat) (pPM-C-HA)

PV260528 500 ng
EUR 603

CLK3 Protein Vector (Rat) (pPM-C-His)

PV260529 500 ng
EUR 603

Clk3 3'UTR Luciferase Stable Cell Line

TU202478 1.0 ml Ask for price

Clk3 3'UTR GFP Stable Cell Line

TU154030 1.0 ml Ask for price

CLK3 3'UTR Luciferase Stable Cell Line

TU004592 1.0 ml
EUR 1394

Clk3 3'UTR Luciferase Stable Cell Line

TU104030 1.0 ml Ask for price

CLK3 3'UTR GFP Stable Cell Line

TU054592 1.0 ml
EUR 1394

Clk3 3'UTR GFP Stable Cell Line

TU252478 1.0 ml Ask for price

CLK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661057 1.0 ug DNA
EUR 682

CLK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661061 1.0 ug DNA
EUR 682

CLK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661062 1.0 ug DNA
EUR 682

CLK3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708795 1.0 ug DNA
EUR 316

CLK3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708799 1.0 ug DNA
EUR 316

CLK3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708800 1.0 ug DNA
EUR 316

CLK3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708801 1.0 ug DNA
EUR 316

CLK3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708805 1.0 ug DNA
EUR 316

CLK3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708806 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

CLK3 Rabbit Polyclonal Antibody