CNNM3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CNNM3 Polyclonal Antibody

ABP58209-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNNM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNNM3 from Human. This CNNM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM3 protein

CNNM3 Polyclonal Antibody

ES10746-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CNNM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNNM3 Polyclonal Antibody

ES10746-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CNNM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNNM3 Rabbit pAb

A4625-100ul 100 ul
EUR 308

CNNM3 Rabbit pAb

A4625-200ul 200 ul
EUR 459

CNNM3 Rabbit pAb

A4625-20ul 20 ul
EUR 183

CNNM3 Rabbit pAb

A4625-50ul 50 ul
EUR 223

Metal Transporter CNNM3 (CNNM3) Antibody

20-abx003478
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

20-abx210792
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

20-abx211751
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

20-abx111860
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx031044-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx031044-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

20-abx334047
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx231803-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNNM3 antibody

70R-16477 50 ul
EUR 435
Description: Rabbit polyclonal CNNM3 antibody

CNNM3 Antibody

35704-100ul 100ul
EUR 252

CNNM3 antibody

10R-1705 100 ug
EUR 512
Description: Mouse monoclonal CNNM3 antibody

CNNM3 Antibody

1-CSB-PA843333LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

CNNM3 Antibody

1-CSB-PA005660GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNNM3 Antibody

DF2572 200ul
EUR 304
Description: CNNM3 antibody detects endogenous levels of total CNNM3.

CNNM3 Antibody

1-CSB-PA254306
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CNNM3 Antibody

1-CSB-PA161346
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

CNNM3 Antibody

ABD2572 100 ug
EUR 438

Metal Transporter CNNM3 (CNNM3) Antibody (HRP)

20-abx336495
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody (FITC)

20-abx336496
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody (Biotin)

20-abx336497
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CNNM3 Conjugated Antibody

C35704 100ul
EUR 397

anti- CNNM3 antibody

FNab01803 100µg
EUR 505.25
  • Immunogen: cyclin M3
  • Uniprot ID: Q8NE01
  • Gene ID: 26505
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CNNM3

Anti-CNNM3 antibody

PAab01803 100 ug
EUR 355

Anti-CNNM3 antibody

STJ116252 100 µl
EUR 277

Anti-CNNM3 antibody

STJ191904 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNNM3

CNNM3 siRNA

20-abx912265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNNM3 siRNA

20-abx912266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pBlueScriptR-CNNM3

PVT17374 2 ug
EUR 258

CNNM3 Antibody, HRP conjugated

1-CSB-PA843333LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNNM3 Antibody, FITC conjugated

1-CSB-PA843333LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNNM3 Antibody, Biotin conjugated

1-CSB-PA843333LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Metal Transporter CNNM3 (CNNM3) ELISA Kit

abx386601-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Metal transporter CNNM3, CNNM3 ELISA KIT

ELI-31876h 96 Tests
EUR 824

Mouse Metal transporter CNNM3, Cnnm3 ELISA KIT

ELI-46826m 96 Tests
EUR 865

CNNM3 Blocking Peptide

DF2572-BP 1mg
EUR 195

CNNM3 cloning plasmid

CSB-CL843333HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgctggacgccagcaccgtgctggacttcggcgtcctggccagcatcatgcagagcggccacacgcgcatcccggtgtacgaggaggagcgctccaacatcgtggacatgctctacctcaaggacttggccttcgtggatcccgaagactgcacgccgctcagcaccatcactc
  • Show more
Description: A cloning plasmid for the CNNM3 gene.

CNNM3 ELISA KIT|Human

EF008756 96 Tests
EUR 689

Human CNNM3 shRNA Plasmid

20-abx958836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CNNM3 shRNA Plasmid

20-abx979293
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNNM3 Recombinant Protein (Human)

RP007498 100 ug Ask for price

CNNM3 Recombinant Protein (Rat)

RP195617 100 ug Ask for price

CNNM3 Recombinant Protein (Mouse)

RP125024 100 ug Ask for price

CNNM3 Recombinant Protein (Mouse)

RP125027 100 ug Ask for price

Cnnm3 ORF Vector (Rat) (pORF)

ORF065207 1.0 ug DNA
EUR 506

CNNM3 ORF Vector (Human) (pORF)

ORF002500 1.0 ug DNA
EUR 95

Cnnm3 ORF Vector (Mouse) (pORF)

ORF041676 1.0 ug DNA
EUR 506

Cnnm3 ORF Vector (Mouse) (pORF)

ORF041677 1.0 ug DNA
EUR 506

CNNM3 sgRNA CRISPR Lentivector set (Human)

K0476201 3 x 1.0 ug
EUR 339

Cnnm3 sgRNA CRISPR Lentivector set (Rat)

K6684801 3 x 1.0 ug
EUR 339

Cnnm3 sgRNA CRISPR Lentivector set (Mouse)

K3456001 3 x 1.0 ug
EUR 339

Rat Cyclin M3(CNNM3) ELISA Kit

QY-E11755 96T
EUR 374

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0476202 1.0 ug DNA
EUR 154

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0476203 1.0 ug DNA
EUR 154

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0476204 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6684802 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6684803 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6684804 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3456002 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3456003 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3456004 1.0 ug DNA
EUR 154

CNNM3 Protein Vector (Mouse) (pPB-C-His)

PV166702 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-N-His)

PV166703 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-HA)

PV166704 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-His)

PV166705 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-C-His)

PV166706 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-N-His)

PV166707 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-HA)

PV166708 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-His)

PV166709 500 ng
EUR 1065

CNNM3 Protein Vector (Rat) (pPB-C-His)

PV260826 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPB-N-His)

PV260827 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPM-C-HA)

PV260828 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPM-C-His)

PV260829 500 ng
EUR 1191

CNNM3 Protein Vector (Human) (pPB-C-His)

PV009997 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPB-N-His)

PV009998 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPM-C-HA)

PV009999 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPM-C-His)

PV010000 500 ng
EUR 329

Cnnm3 3'UTR GFP Stable Cell Line

TU154106 1.0 ml Ask for price

Cnnm3 3'UTR Luciferase Stable Cell Line

TU104106 1.0 ml Ask for price

Cnnm3 3'UTR Luciferase Stable Cell Line

TU202552 1.0 ml Ask for price

Cnnm3 3'UTR GFP Stable Cell Line

TU252552 1.0 ml Ask for price

CNNM3 3'UTR GFP Stable Cell Line

TU054695 1.0 ml
EUR 1394

CNNM3 3'UTR Luciferase Stable Cell Line

TU004695 1.0 ml
EUR 1394

CNNM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651445 1.0 ug DNA
EUR 1355

CNNM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651449 1.0 ug DNA
EUR 1355

CNNM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651450 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

CNNM3 Rabbit Polyclonal Antibody