DEDD Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
DEDD Polyclonal Antibody |
ES10681-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DEDD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DEDD Polyclonal Antibody |
ABP58349-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170 |
DEDD Polyclonal Antibody |
ABP58349-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170 |
DEDD Polyclonal Antibody |
ABP58349-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170 |
DEDD Polyclonal Antibody |
30666-100ul |
SAB |
100ul |
EUR 252 |
DEDD Polyclonal Antibody |
30666-50ul |
SAB |
50ul |
EUR 187 |
DEDD Rabbit pAb |
A5806-100ul |
Abclonal |
100 ul |
EUR 308 |
DEDD Rabbit pAb |
A5806-200ul |
Abclonal |
200 ul |
EUR 459 |
DEDD Rabbit pAb |
A5806-20ul |
Abclonal |
20 ul |
EUR 183 |
DEDD Rabbit pAb |
A5806-50ul |
Abclonal |
50 ul |
EUR 223 |
DEDD Polyclonal Conjugated Antibody |
C30666 |
SAB |
100ul |
EUR 397 |
DEDD antibody |
22334-100ul |
SAB |
100ul |
EUR 390 |
DEDD antibody |
70R-13451 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal DEDD antibody |
DEDD antibody |
70R-16797 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DEDD antibody |
DEDD Antibody |
DF10100 |
Affbiotech |
200ul |
EUR 304 |
Description: DEDD Antibody detects endogenous levels of total DEDD. |
DEDD Antibody |
1-CSB-PA006648ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
DEDD Antibody |
1-CSB-PA006648ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DEDD Antibody |
1-CSB-PA006648GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
anti- DEDD antibody |
FNab02323 |
FN Test |
100µg |
EUR 585 |
- Immunogen: death effector domain containing
- Uniprot ID: O75618
- Gene ID: 9191
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against DEDD |
Anti-DEDD antibody |
STJ28369 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene. |
Anti-DEDD antibody |
STJ191839 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DEDD |
DEDD siRNA |
20-abx901465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DEDD siRNA |
20-abx913849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DEDD siRNA |
20-abx913850 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DEDD |
YF-PA25284 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to DEDD |
DEDD cloning plasmid |
CSB-CL006648HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 957
- Sequence: atggcgggcctaaagcggcgggcaagccaggtgtggccagaagagcatggtgagcaggaacatgggctgtacagcctgcaccgcatgtttgacatcgtgggcactcatctgacacacagagatgtgcgcgtgctttctttcctctttgttgatgtcattgatgaccacgagcgtgg
- Show more
|
Description: A cloning plasmid for the DEDD gene. |
DEDD Blocking Peptide |
DF10100-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-DEDD (1C7) |
YF-MA16708 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DEDD |
Rat DEDD shRNA Plasmid |
20-abx986826 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DEDD shRNA Plasmid |
20-abx956083 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DEDD protein (His tag) |
80R-2649 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant Human DEDD protein (His tag) |
Mouse DEDD shRNA Plasmid |
20-abx973166 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DEDD Recombinant Protein (Human) |
RP009070 |
ABM |
100 ug |
Ask for price |
DEDD Recombinant Protein (Rat) |
RP197711 |
ABM |
100 ug |
Ask for price |
DEDD Recombinant Protein (Mouse) |
RP128495 |
ABM |
100 ug |
Ask for price |
DEDD Recombinant Protein (Mouse) |
RP128498 |
ABM |
100 ug |
Ask for price |
Death Effector Domain Containing (DEDD) Antibody |
20-abx112000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
abx122544-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
abx149765-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
20-abx004448 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
20-abx320685 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
20-abx322366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Death Effector Domain Containing (DEDD) Antibody |
abx232323-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Monoclonal DEDD Antibody (monoclonal) (M01), Clone: 1C7 |
AMM03455G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human DEDD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C7. This antibody is applicable in WB |
DEDD ORF Vector (Human) (pORF) |
ORF003024 |
ABM |
1.0 ug DNA |
EUR 95 |
Dedd ORF Vector (Rat) (pORF) |
ORF065905 |
ABM |
1.0 ug DNA |
EUR 506 |
Dedd ORF Vector (Mouse) (pORF) |
ORF042833 |
ABM |
1.0 ug DNA |
EUR 506 |
DEDD Rabbit Polyclonal Antibody