DEDD Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

DEDD Polyclonal Antibody
ES10681-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DEDD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DEDD Polyclonal Antibody
ABP58349-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
DEDD Polyclonal Antibody
ABP58349-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
DEDD Polyclonal Antibody
ABP58349-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of DEDD from Human, Mouse, Rat. This DEDD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEDD protein at amino acid sequence of 90-170
DEDD Polyclonal Antibody
30666-100ul 100ul
EUR 252
DEDD Polyclonal Antibody
30666-50ul 50ul
EUR 187
DEDD Rabbit pAb
A5806-100ul 100 ul
EUR 308
DEDD Rabbit pAb
A5806-200ul 200 ul
EUR 459
DEDD Rabbit pAb
A5806-20ul 20 ul
EUR 183
DEDD Rabbit pAb
A5806-50ul 50 ul
EUR 223
DEDD Polyclonal Conjugated Antibody
C30666 100ul
EUR 397
DEDD Antibody
ABD10100 100 ug
EUR 438
DEDD antibody
22334-100ul 100ul
EUR 390
DEDD antibody
70R-13451 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DEDD antibody
DEDD antibody
70R-16797 50 ul
EUR 435
Description: Rabbit polyclonal DEDD antibody
DEDD Antibody
DF10100 200ul
EUR 304
Description: DEDD Antibody detects endogenous levels of total DEDD.
DEDD Antibody
1-CSB-PA006648ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
DEDD Antibody
1-CSB-PA006648ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
DEDD Antibody
1-CSB-PA006648GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
Dedd/ Rat Dedd ELISA Kit
ELI-32183r 96 Tests
EUR 886
anti- DEDD antibody
FNab02323 100µg
EUR 585
  • Immunogen: death effector domain containing
  • Uniprot ID: O75618
  • Gene ID: 9191
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against DEDD
Anti-DEDD antibody
PAab02323 100 ug
EUR 412
Anti-DEDD antibody
STJ28369 100 µl
EUR 277
Description: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene.
Anti-DEDD antibody
STJ191839 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DEDD
DEDD siRNA
20-abx901465
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DEDD siRNA
20-abx913849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DEDD siRNA
20-abx913850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-DEDD
YF-PA25284 50 ul
EUR 334
Description: Mouse polyclonal to DEDD
DEDD cloning plasmid
CSB-CL006648HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atggcgggcctaaagcggcgggcaagccaggtgtggccagaagagcatggtgagcaggaacatgggctgtacagcctgcaccgcatgtttgacatcgtgggcactcatctgacacacagagatgtgcgcgtgctttctttcctctttgttgatgtcattgatgaccacgagcgtgg
  • Show more
Description: A cloning plasmid for the DEDD gene.
DEDD Blocking Peptide
DF10100-BP 1mg
EUR 195
Anti-DEDD (1C7)
YF-MA16708 100 ug
EUR 363
Description: Mouse monoclonal to DEDD
Rat DEDD shRNA Plasmid
20-abx986826
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DEDD ELISA KIT|Human
EF009070 96 Tests
EUR 689
Human DEDD shRNA Plasmid
20-abx956083
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DEDD protein (His tag)
80R-2649 50 ug
EUR 424
Description: Purified recombinant Human DEDD protein (His tag)
Mouse DEDD shRNA Plasmid
20-abx973166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DEDD Recombinant Protein (Human)
RP009070 100 ug Ask for price
DEDD Recombinant Protein (Rat)
RP197711 100 ug Ask for price
DEDD Recombinant Protein (Mouse)
RP128495 100 ug Ask for price
DEDD Recombinant Protein (Mouse)
RP128498 100 ug Ask for price
Death Effector Domain Containing (DEDD) Antibody
20-abx112000
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
abx122544-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
abx149765-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
20-abx004448
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
20-abx320685
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
20-abx322366
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Death Effector Domain Containing (DEDD) Antibody
abx232323-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Monoclonal DEDD Antibody (monoclonal) (M01), Clone: 1C7
AMM03455G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DEDD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C7. This antibody is applicable in WB
DEDD ORF Vector (Human) (pORF)
ORF003024 1.0 ug DNA
EUR 95
Dedd ORF Vector (Rat) (pORF)
ORF065905 1.0 ug DNA
EUR 506
Dedd ORF Vector (Mouse) (pORF)
ORF042833 1.0 ug DNA
EUR 506

DEDD Rabbit Polyclonal Antibody