FGF14 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

FGF14 Polyclonal Antibody
ABP58546-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of FGF14 from Human, Mouse, Rat. This FGF14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90

FGF14 Rabbit pAb
A6588-100ul 100 ul
EUR 308

FGF14 Rabbit pAb
A6588-200ul 200 ul
EUR 459

FGF14 Rabbit pAb
A6588-20ul 20 ul
EUR 183

FGF14 Rabbit pAb
A6588-50ul 50 ul
EUR 223

FGF14 antibody
70R-9286 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FGF14 antibody

FGF14 Antibody
ABD13097 100 ug
EUR 438

FGF14 Antibody
ABD2494 100 ug
EUR 438

FGF14 antibody
39028-100ul 100ul
EUR 252

FGF14 Antibody
DF2494 200ul
EUR 304
Description: FGF14 antibody detects endogenous levels of total FGF14.

FGF14 Antibody
1-CSB-PA008620ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF14. Recognizes FGF14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

FGF14 Conjugated Antibody
C39028 100ul
EUR 397

Anti-FGF14 antibody
STJ28671 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene.

Anti-FGF14 antibody
STJ191846 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FGF14

Fgf14/ Rat Fgf14 ELISA Kit
ELI-07770r 96 Tests
EUR 886

FGF14 siRNA
20-abx901945
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF14 siRNA
20-abx916805
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF14 siRNA
20-abx916806
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FGF14
YF-PA23709 50 ul
EUR 334
Description: Mouse polyclonal to FGF14

Polyclonal Fgf14 (mouse N terminus) Antibody (N-Term)
APR11926G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Fgf14 (mouse N terminus) (N-Term). This antibody is tested and proven to work in the following applications:

FGF14 cloning plasmid
CSB-CL008620HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 759
  • Sequence: ATGGTAAAACCGGTGCCCCTCTTCAGGAGAACTGATTTCAAATTATTATTATGCAACCACAAGGATCTCTTCTTTCTCAGGGTGTCTAAGCTGCTGGATTGCTTTTCGCCCAAATCAATGTGGTTTCTTTGGAACATTTTCAGCAAAGGAACGCATATGCTGCAGTGTCTTTGTGG
  • Show more
Description: A cloning plasmid for the FGF14 gene.

FGF14, human recombinant
7347-50
EUR 457

FGF14 Blocking Peptide
33R-2622 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF14 antibody, catalog no. 70R-9286

FGF14 Blocking Peptide
DF2494-BP 1mg
EUR 195

Fibroblast Growth Factor 14 (FGF14) Antibody
abx148512-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx005054
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx321798
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (Fgf14) Antibody
abx431250-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx225169
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Fgf14 (mouse N terminus) antibody
STJ72909 100 µg
EUR 359

Rat FGF14 shRNA Plasmid
20-abx986101
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FGF14 protein (His tag)
80R-2833 50 ug
EUR 424
Description: Purified recombinant FGF14 protein (His tag)

Mouse FGF14 shRNA Plasmid
20-abx970318
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF14 shRNA Plasmid
20-abx951579
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Fgf14 ORF Vector (Rat) (pORF)
ORF067094 1.0 ug DNA
EUR 506

Fgf14 ORF Vector (Mouse) (pORF)
ORF044815 1.0 ug DNA
EUR 506

Fgf14 ORF Vector (Mouse) (pORF)
ORF044816 1.0 ug DNA
EUR 506

FGF14 ORF Vector (Human) (pORF)
ORF013032 1.0 ug DNA
EUR 354

FGF14 ELISA Kit (Human) (OKCA00676)
OKCA00676 96 Wells
EUR 833
Description: Description of target: Probably involved in nervous system development and function. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

FGF14 sgRNA CRISPR Lentivector set (Human)
K0778501 3 x 1.0 ug
EUR 339

Human Fibroblast growth factor 14 (FGF14)
1-CSB-EP008620HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Fibroblast growth factor 14(FGF14) expressed in E.coli

Fgf14 sgRNA CRISPR Lentivector set (Mouse)
K3982801 3 x 1.0 ug
EUR 339

Fgf14 sgRNA CRISPR Lentivector set (Rat)
K6794701 3 x 1.0 ug
EUR 339

FGF14-AS1 ORF Vector (Human) (pORF)
ORF019583 1.0 ug DNA Ask for price

FGF14-IT1 ORF Vector (Human) (pORF)
ORF019584 1.0 ug DNA Ask for price

FGF14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0778502 1.0 ug DNA
EUR 154

FGF14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0778503 1.0 ug DNA
EUR 154

FGF14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0778504 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3982802 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3982803 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3982804 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6794702 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6794703 1.0 ug DNA
EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6794704 1.0 ug DNA
EUR 154

FGF14 Protein Vector (Human) (pPB-C-His)
PV052125 500 ng
EUR 481

FGF14 Protein Vector (Human) (pPB-N-His)
PV052126 500 ng
EUR 481

FGF14 Protein Vector (Human) (pPM-C-HA)
PV052127 500 ng
EUR 481

FGF14 Protein Vector (Human) (pPM-C-His)
PV052128 500 ng
EUR 481

FGF14 Rabbit Polyclonal Antibody