FGF14 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
FGF14 Polyclonal Antibody |
ABP58546-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of FGF14 from Human, Mouse, Rat. This FGF14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90 |
FGF14 Rabbit pAb |
A6588-100ul |
Abclonal |
100 ul |
EUR 308 |
FGF14 Rabbit pAb |
A6588-200ul |
Abclonal |
200 ul |
EUR 459 |
FGF14 Rabbit pAb |
A6588-20ul |
Abclonal |
20 ul |
EUR 183 |
FGF14 Rabbit pAb |
A6588-50ul |
Abclonal |
50 ul |
EUR 223 |
FGF14 antibody |
70R-9286 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal FGF14 antibody |
FGF14 antibody |
39028-100ul |
SAB |
100ul |
EUR 252 |
FGF14 Antibody |
DF2494 |
Affbiotech |
200ul |
EUR 304 |
Description: FGF14 antibody detects endogenous levels of total FGF14. |
FGF14 Antibody |
1-CSB-PA008620ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FGF14. Recognizes FGF14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
FGF14 Conjugated Antibody |
C39028 |
SAB |
100ul |
EUR 397 |
Anti-FGF14 antibody |
STJ28671 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. |
Anti-FGF14 antibody |
STJ191846 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FGF14 |
FGF14 siRNA |
20-abx901945 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FGF14 siRNA |
20-abx916805 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FGF14 siRNA |
20-abx916806 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FGF14 |
YF-PA23709 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to FGF14 |
Polyclonal Fgf14 (mouse N terminus) Antibody (N-Term) |
APR11926G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Fgf14 (mouse N terminus) (N-Term). This antibody is tested and proven to work in the following applications: |
FGF14 cloning plasmid |
CSB-CL008620HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 759
- Sequence: ATGGTAAAACCGGTGCCCCTCTTCAGGAGAACTGATTTCAAATTATTATTATGCAACCACAAGGATCTCTTCTTTCTCAGGGTGTCTAAGCTGCTGGATTGCTTTTCGCCCAAATCAATGTGGTTTCTTTGGAACATTTTCAGCAAAGGAACGCATATGCTGCAGTGTCTTTGTGG
- Show more
|
Description: A cloning plasmid for the FGF14 gene. |
FGF14, human recombinant |
7347-50 |
Biovision |
|
EUR 457 |
FGF14 Blocking Peptide |
33R-2622 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF14 antibody, catalog no. 70R-9286 |
FGF14 Blocking Peptide |
DF2494-BP |
Affbiotech |
1mg |
EUR 195 |
Fibroblast Growth Factor 14 (FGF14) Antibody |
abx148512-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Fibroblast Growth Factor 14 (FGF14) Antibody |
20-abx005054 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fibroblast Growth Factor 14 (FGF14) Antibody |
20-abx321798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fibroblast Growth Factor 14 (Fgf14) Antibody |
abx431250-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Fibroblast Growth Factor 14 (FGF14) Antibody |
20-abx225169 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Rat FGF14 shRNA Plasmid |
20-abx986101 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FGF14 protein (His tag) |
80R-2833 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant FGF14 protein (His tag) |
Mouse FGF14 shRNA Plasmid |
20-abx970318 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FGF14 shRNA Plasmid |
20-abx951579 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Fgf14 ORF Vector (Rat) (pORF) |
ORF067094 |
ABM |
1.0 ug DNA |
EUR 506 |
Fgf14 ORF Vector (Mouse) (pORF) |
ORF044815 |
ABM |
1.0 ug DNA |
EUR 506 |
Fgf14 ORF Vector (Mouse) (pORF) |
ORF044816 |
ABM |
1.0 ug DNA |
EUR 506 |
FGF14 ORF Vector (Human) (pORF) |
ORF013032 |
ABM |
1.0 ug DNA |
EUR 354 |
FGF14 ELISA Kit (Human) (OKCA00676) |
OKCA00676 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Probably involved in nervous system development and function. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL |
FGF14 sgRNA CRISPR Lentivector set (Human) |
K0778501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Fibroblast growth factor 14 (FGF14) |
1-CSB-EP008620HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Fibroblast growth factor 14(FGF14) expressed in E.coli |
Fgf14 sgRNA CRISPR Lentivector set (Mouse) |
K3982801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fgf14 sgRNA CRISPR Lentivector set (Rat) |
K6794701 |
ABM |
3 x 1.0 ug |
EUR 339 |
FGF14-AS1 ORF Vector (Human) (pORF) |
ORF019583 |
ABM |
1.0 ug DNA |
Ask for price |
FGF14-IT1 ORF Vector (Human) (pORF) |
ORF019584 |
ABM |
1.0 ug DNA |
Ask for price |
FGF14 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0778502 |
ABM |
1.0 ug DNA |
EUR 154 |
FGF14 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0778503 |
ABM |
1.0 ug DNA |
EUR 154 |
FGF14 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0778504 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3982802 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3982803 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3982804 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6794702 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6794703 |
ABM |
1.0 ug DNA |
EUR 154 |
Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6794704 |
ABM |
1.0 ug DNA |
EUR 154 |
FGF14 Protein Vector (Human) (pPB-C-His) |
PV052125 |
ABM |
500 ng |
EUR 481 |
FGF14 Protein Vector (Human) (pPB-N-His) |
PV052126 |
ABM |
500 ng |
EUR 481 |
FGF14 Protein Vector (Human) (pPM-C-HA) |
PV052127 |
ABM |
500 ng |
EUR 481 |
FGF14 Protein Vector (Human) (pPM-C-His) |
PV052128 |
ABM |
500 ng |
EUR 481 |
FGF14 Rabbit Polyclonal Antibody