FLRT3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

FLRT3 Polyclonal Antibody

ABP58573-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FLRT3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT3 from Human, Rat. This FLRT3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT3 protein

FLRT3 Polyclonal Antibody

ES10919-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT3 Polyclonal Antibody

ES10919-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FLRT3 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT3 Antibody

1-CSB-PA882162LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200

Flrt3/ Rat Flrt3 ELISA Kit

ELI-32531r 96 Tests
EUR 886

Human FLRT3 Antibody

32228-05111 150 ug
EUR 261

Anti-FLRT3 antibody

STJ192077 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT3

FLRT3 protein

80R-4349 50 ug
EUR 349
Description: Purified Recombinant FLRT3 protein (His tagged)

FLRT3 siRNA

20-abx916978
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLRT3 siRNA

20-abx916979
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLRT3 Antibody, HRP conjugated

1-CSB-PA882162LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FLRT3 Antibody, FITC conjugated

1-CSB-PA882162LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FLRT3 Antibody, Biotin conjugated

1-CSB-PA882162LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT3. Recognizes FLRT3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FLRT3 cloning plasmid

CSB-CL882162HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1950
  • Sequence: atgatcagcgcagcctggagcatcttcctcatcgggactaaaattgggctgttccttcaagtagcacctctatcagttatggctaaatcctgtccatctgtgtgtcgctgcgatgcgggtttcatttactgtaatgatcgctttctgacatccattccaacaggaataccagagg
  • Show more
Description: A cloning plasmid for the FLRT3 gene.

Human FLRT3 Antibody (Biotin Conjugate)

32228-05121 150 ug
EUR 369

Human FLRT3 ELISA KIT

ELI-26715h 96 Tests
EUR 824

Rat FLRT3 shRNA Plasmid

20-abx990654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FLRT3 shRNA Plasmid

20-abx958455
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLRT3 Recombinant Protein (Human)

RP012355 100 ug Ask for price

FLRT3 Recombinant Protein (Rat)

RP201542 100 ug Ask for price

FLRT3 Recombinant Protein (Mouse)

RP134804 100 ug Ask for price

FLRT3 Recombinant Protein (Mouse)

RP134807 100 ug Ask for price

Human FLRT3 AssayLite Antibody (FITC Conjugate)

32228-05141 150 ug
EUR 428

Human FLRT3 AssayLite Antibody (RPE Conjugate)

32228-05151 150 ug
EUR 428

Human FLRT3 AssayLite Antibody (APC Conjugate)

32228-05161 150 ug
EUR 428

Human FLRT3 AssayLite Antibody (PerCP Conjugate)

32228-05171 150 ug
EUR 471

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human)

4-PAF453Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3)

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Recombinant Human Leucine-Rich Repeat Transmembrane Protein FLRT3/FLRT3 (C-6His)

C970-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.2.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), APC

4-PAF453Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with APC.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), Biotinylated

4-PAF453Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with Biotin.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), Cy3

4-PAF453Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with Cy3.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), FITC

4-PAF453Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with FITC.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), HRP

4-PAF453Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with HRP.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), PE

4-PAF453Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with PE.

Human FLRT3 PicoKine ELISA Kit

EK1974 96 wells
EUR 425
Description: For quantitative detection of human FLRT3 in cell culture supernates, serum and plasma (heparin, EDTA).

Flrt3 ORF Vector (Rat) (pORF)

ORF067182 1.0 ug DNA
EUR 506

FLRT3 ORF Vector (Human) (pORF)

ORF004119 1.0 ug DNA
EUR 95

Flrt3 ORF Vector (Mouse) (pORF)

ORF044936 1.0 ug DNA
EUR 506

Flrt3 ORF Vector (Mouse) (pORF)

ORF044937 1.0 ug DNA
EUR 506

FLRT3 ELISA Kit (Human) (OKCD00701)

OKCD00701 96 Wells
EUR 831
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance, exerting an attractive or repulsive role depending on its interaction partners. Plays a role in the spatial organization of brain neurons. Plays a role in vascular development in the retina (By similarity). Plays a role in cell-cell adhesion via its interaction with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells (PubMed:26235030). Interaction with the intracellular domain of ROBO1 mediates axon attraction towards cells expressing NTN1. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5B, and possibly also other UNC-5 family members (By similarity). Promotes neurite outgrowth (in vitro) (PubMed:14706654). Mediates cell-cell contacts that promote an increase both in neurite number and in neurite length. Plays a role in the regulation of the density of glutamaergic synapses. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal morphogenesis during embryonic development, but not for normal embryonic patterning. Required for normal ventral closure, headfold fusion and definitive endoderm migration during embryonic development. Required for the formation of a normal basement membrane and the maintenance of a normal anterior visceral endoderm during embryonic development (By similarity).By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:B1H234 (FLRT3_RAT)UniProtKB:Q8BGT1 (FLRT3_MOUSE)2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"FLRT3, a cell surface molecule containing LRR repeats and a FNIII domain, promotes neurite outgrowth."_x005F_x005F_x000D_Tsuji L., Yamashita T., Kubo T., Madura T., Tanaka H., Hosokawa K., Tohyama M._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 313:1086-1091(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, TOPOLOGY.Ref.11"Structural basis of latrophilin-FLRT-UNC5 interaction in cell adhesion."_x005F_x005F_x000D_Lu Y.C., Nazarko O.V., Sando R. III, Salzman G.S., Suedhof T.C., Arac D._x005F_x005F_x000D_Structure 23:1678-1691(2015) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.6 ANGSTROMS) OF 29-357 IN COMPLEX WITH ADGRL3, SUBUNIT, INTERACTION WITH ADGRL3; UNC5B AND UNC5D, SUBCELLULAR LOCATION, DISULFIDE BOND, GLYCOSYLATION AT ASN-226, MUTAGENESIS OF ASP-38; TYR-43; ASN-45; ARG-47; TYR-64; TYR-89; TYR-91; ARG-181 AND ASP-183. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.57 ng/mL

FLRT3 ELISA Kit (Human) (OKBB01348)

OKBB01348 96 Wells
EUR 505
Description: Description of target: Leucine-rich repeat transmembrane protein FLRT3 is a protein that in humans is encoded by the FLRT3 gene. It is mapped to 20p12.1. This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Polyclonal Antibody (Human), APC-Cy7

4-PAF453Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT3 (Lys29~Asp152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3). This antibody is labeled with APC-Cy7.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody

20-abx128321
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody

20-abx172433
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody

20-abx318730
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Flrt3 sgRNA CRISPR Lentivector set (Rat)

K6660001 3 x 1.0 ug
EUR 339

FLRT3 sgRNA CRISPR Lentivector set (Human)

K0788001 3 x 1.0 ug
EUR 339

Flrt3 sgRNA CRISPR Lentivector set (Mouse)

K4748601 3 x 1.0 ug
EUR 339

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody (HRP)

20-abx313920
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody (FITC)

20-abx313921
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibronectin Leucine Rich Transmembrane Protein 3 (FLRT3) Antibody (Biotin)

20-abx313922
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Flrt3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6660002 1.0 ug DNA
EUR 154

FLRT3 Rabbit Polyclonal Antibody