IDS Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

IDS Polyclonal Antibody

ABP58868-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDS from Human. This IDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDS protein

IDS Polyclonal Antibody

ABP58868-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDS from Human. This IDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDS protein

IDS Polyclonal Antibody

ES10912-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IDS Polyclonal Antibody

ES10912-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-48T 48T
EUR 517
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-96T 96T
EUR 673
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-48Tests 48 Tests
EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-96Tests 96 Tests
EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-48Tests 48 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-96Tests 96 Tests
EUR 723

IDS Rabbit pAb

A1857-100ul 100 ul
EUR 308

IDS Rabbit pAb

A1857-200ul 200 ul
EUR 459

IDS Rabbit pAb

A1857-20ul 20 ul
EUR 183

IDS Rabbit pAb

A1857-50ul 50 ul
EUR 223

Polyclonal IDS Antibody (Internal)

APG01181G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDS (Internal). This antibody is tested and proven to work in the following applications:

IDS Polyclonal Conjugated Antibody

C31899 100ul
EUR 397

IDS Polyclonal Conjugated Antibody

C30396 100ul
EUR 397

IDS antibody

70R-10208 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal IDS antibody

IDS antibody

31899-100ul 100ul
EUR 252

IDS antibody

31899-50ul 50ul
EUR 187

IDS antibody

10R-6986 100 ul
EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody

10R-6987 100 ul
EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody

10R-6988 100 ul
EUR 726
Description: Mouse monoclonal IDS antibody

Rabbit IDS ELISA Kit

ERTI0341 96Tests
EUR 521

Polyclonal Goat Anti-IDS Antibody

APG00165G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IDS . This antibody is tested and proven to work in the following applications:

Anti-IDS antibody

STJ24123 100 µl
EUR 277
Description: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

Anti-IDS antibody

STJ71754 100 µg
EUR 359

Anti-IDS antibody

STJ192070 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IDS

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse)

4-PAH833Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat)

4-PAH833Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS)

IDS siRNA

20-abx920158
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IDS siRNA

20-abx920159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse)

4-PAH833Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC

4-PAH833Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Biotinylated

4-PAH833Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Cy3

4-PAH833Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), FITC

4-PAH833Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), HRP

4-PAH833Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), PE

4-PAH833Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC

4-PAH833Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Biotinylated

4-PAH833Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Cy3

4-PAH833Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), FITC

4-PAH833Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), HRP

4-PAH833Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), PE

4-PAH833Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

IDS Blocking Peptide

33R-8437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IDS antibody, catalog no. 70R-10208

IDS cloning plasmid

CSB-CL010998HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atgccgccaccccggaccggccgaggccttctctggctgggtctggttctgagctccgtctgcgtcgccctcggatccgaaacgcaggccaactcgaccacagatgctctgaacgttcttctcatcatcgtggatgacctgcgcccctccctgggctgttatggggataagctggt
  • Show more
Description: A cloning plasmid for the IDS gene.

Iduronate 2-Sulfatase (IDS) Antibody

20-abx006700
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

IDS Rabbit Polyclonal Antibody