IFRD1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
IFRD1 Polyclonal Antibody |
ABP58895-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IFRD1 protein at amino acid sequence of 280-360
- Applications tips:
|
Description: A polyclonal antibody for detection of IFRD1 from Human, Mouse, Rat. This IFRD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFRD1 protein at amino acid sequence of 280-360 |
IFRD1 Polyclonal Antibody |
ES10569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IFRD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IFRD1 Polyclonal Antibody |
ES10569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IFRD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IFRD1 Rabbit pAb |
A13318-100ul |
Abclonal |
100 ul |
EUR 308 |
IFRD1 Rabbit pAb |
A13318-200ul |
Abclonal |
200 ul |
EUR 459 |
IFRD1 Rabbit pAb |
A13318-20ul |
Abclonal |
20 ul |
EUR 183 |
IFRD1 Rabbit pAb |
A13318-50ul |
Abclonal |
50 ul |
EUR 223 |
IFRD1 Rabbit pAb |
A7439-100ul |
Abclonal |
100 ul |
EUR 308 |
IFRD1 Rabbit pAb |
A7439-200ul |
Abclonal |
200 ul |
EUR 459 |
IFRD1 Rabbit pAb |
A7439-20ul |
Abclonal |
20 ul |
EUR 183 |
IFRD1 Rabbit pAb |
A7439-50ul |
Abclonal |
50 ul |
EUR 223 |
IFRD1 antibody |
70R-17899 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal IFRD1 antibody |
IFRD1 antibody |
70R-1986 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal IFRD1 antibody raised against the N terminal of IFRD1 |
IFRD1 Antibody |
36546-100ul |
SAB |
100ul |
EUR 252 |
IFRD1 Antibody |
1-CSB-PA698625 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against IFRD1. Recognizes IFRD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
IFRD1 Antibody |
DF2392 |
Affbiotech |
200ul |
EUR 304 |
Description: IFRD1 antibody detects endogenous levels of total IFRD1. |
IFRD1 Antibody |
1-CSB-PA286863 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against IFRD1. Recognizes IFRD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
IFRD1 antibody |
70R-3682 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal IFRD1 antibody raised against the middle region of IFRD1 |
IFRD1 Antibody |
1-CSB-PA011069ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against IFRD1. Recognizes IFRD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
IFRD1 Antibody |
1-CSB-PA011069GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against IFRD1. Recognizes IFRD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
IFRD1 Conjugated Antibody |
C36546 |
SAB |
100ul |
EUR 397 |
anti- IFRD1 antibody |
FNab04151 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: interferon-related developmental regulator 1
- Uniprot ID: O00458
- Gene ID: 3475
- Research Area: Developmental biology
|
Description: Antibody raised against IFRD1 |
Anti-IFRD1 antibody |
STJ115282 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. |
Anti-IFRD1 antibody |
STJ29575 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. |
Anti-IFRD1 antibody |
STJ191727 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IFRD1 |
IFRD1 siRNA |
20-abx902615 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IFRD1 siRNA |
20-abx920257 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IFRD1 siRNA |
20-abx920258 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-IFRD1 |
YF-PA12615 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to IFRD1 |
IFRD1 Blocking Peptide |
33R-4784 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IFRD1 antibody, catalog no. 70R-3682 |
IFRD1 Blocking Peptide |
33R-9754 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IFRD1 antibody, catalog no. 70R-1986 |
IFRD1 Blocking Peptide |
DF2392-BP |
Affbiotech |
1mg |
EUR 195 |
IFRD1 cloning plasmid |
CSB-CL011069HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1356
- Sequence: atgccgaagaacaagaagcggaacactccccaccgcggtagcagtgctggcggcggcgggtcaggagcagccgcagcgacggcggcgacagcaggtggccagcatcgaaatgttcagccttttagtgatgaagatgcatcaattgaaacaatgagccattgcagtggttatagcg
- Show more
|
Description: A cloning plasmid for the IFRD1 gene. |
Rat IFRD1 shRNA Plasmid |
20-abx985611 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human IFRD1 shRNA Plasmid |
20-abx952348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse IFRD1 shRNA Plasmid |
20-abx970983 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
IFRD1 Recombinant Protein (Human) |
RP015655 |
ABM |
100 ug |
Ask for price |
IFRD1 Recombinant Protein (Rat) |
RP205559 |
ABM |
100 ug |
Ask for price |
IFRD1 Recombinant Protein (Mouse) |
RP143108 |
ABM |
100 ug |
Ask for price |
Rabbit Interferon related developmental regulator 1(IFRD1) ELISA kit |
E04I0429-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon related developmental regulator 1(IFRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interferon related developmental regulator 1(IFRD1) ELISA kit |
E04I0429-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon related developmental regulator 1(IFRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interferon related developmental regulator 1(IFRD1) ELISA kit |
E04I0429-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interferon related developmental regulator 1(IFRD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
20-abx006953 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
20-abx113224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
abx145623-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
20-abx241546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
20-abx241547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
abx234151-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Interferon-Related Developmental Regulator 1 (IFRD1) Antibody |
20-abx322480 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ifrd1 ORF Vector (Rat) (pORF) |
ORF068521 |
ABM |
1.0 ug DNA |
EUR 506 |
IFRD1 ORF Vector (Human) (pORF) |
ORF005219 |
ABM |
1.0 ug DNA |
EUR 95 |
Ifrd1 ORF Vector (Mouse) (pORF) |
ORF047704 |
ABM |
1.0 ug DNA |
EUR 506 |
IFRD1 ELISA Kit (Rat) (OKWB00366) |
OKWB00366 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: Probably participates in neurogenesis. Could play a role in regulating gene activity in the proliferative and/or differentiative pathways induced by NGF. ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL |
Ifrd1 sgRNA CRISPR Lentivector set (Rat) |
K6803701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ifrd1 sgRNA CRISPR Lentivector set (Mouse) |
K3426001 |
ABM |
3 x 1.0 ug |
EUR 339 |
IFRD1 sgRNA CRISPR Lentivector set (Human) |
K1022701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ifrd1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6803702 |
ABM |
1.0 ug DNA |
EUR 154 |
Ifrd1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6803703 |
ABM |
1.0 ug DNA |
EUR 154 |
Ifrd1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6803704 |
ABM |
1.0 ug DNA |
EUR 154 |
Ifrd1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3426002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ifrd1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3426003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ifrd1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3426004 |
ABM |
1.0 ug DNA |
EUR 154 |
IFRD1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1022702 |
ABM |
1.0 ug DNA |
EUR 154 |
IFRD1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1022703 |
ABM |
1.0 ug DNA |
EUR 154 |
IFRD1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1022704 |
ABM |
1.0 ug DNA |
EUR 154 |
IFRD1 Protein Vector (Human) (pPB-C-His) |
PV020873 |
ABM |
500 ng |
EUR 329 |
IFRD1 Protein Vector (Human) (pPB-N-His) |
PV020874 |
ABM |
500 ng |
EUR 329 |
IFRD1 Protein Vector (Human) (pPM-C-HA) |
PV020875 |
ABM |
500 ng |
EUR 329 |
IFRD1 Protein Vector (Human) (pPM-C-His) |
PV020876 |
ABM |
500 ng |
EUR 329 |
IFRD1 Protein Vector (Rat) (pPB-C-His) |
PV274082 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Rat) (pPB-N-His) |
PV274083 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Rat) (pPM-C-HA) |
PV274084 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Rat) (pPM-C-His) |
PV274085 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Mouse) (pPB-C-His) |
PV190814 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Mouse) (pPB-N-His) |
PV190815 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Mouse) (pPM-C-HA) |
PV190816 |
ABM |
500 ng |
EUR 603 |
IFRD1 Protein Vector (Mouse) (pPM-C-His) |
PV190817 |
ABM |
500 ng |
EUR 603 |
Ifrd1 3'UTR Luciferase Stable Cell Line |
TU109940 |
ABM |
1.0 ml |
Ask for price |
Ifrd1 3'UTR GFP Stable Cell Line |
TU159940 |
ABM |
1.0 ml |
Ask for price |
Ifrd1 3'UTR Luciferase Stable Cell Line |
TU206131 |
ABM |
1.0 ml |
Ask for price |
Ifrd1 3'UTR GFP Stable Cell Line |
TU256131 |
ABM |
1.0 ml |
Ask for price |
IFRD1 3'UTR GFP Stable Cell Line |
TU060502 |
ABM |
1.0 ml |
EUR 1394 |
IFRD1 3'UTR Luciferase Stable Cell Line |
TU010502 |
ABM |
1.0 ml |
EUR 1394 |
Porcine Interferon- related developmental regulator 1, IFRD1 ELI |
ELI-20138p |
Lifescience Market |
96 Tests |
EUR 928 |
IFRD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV672601 |
ABM |
1.0 ug DNA |
EUR 682 |
IFRD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV672605 |
ABM |
1.0 ug DNA |
EUR 682 |
IFRD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV672606 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
IFRD1 Rabbit Polyclonal Antibody