ING3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ING3 Polyclonal Antibody
ES10794-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ING3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ING3 Polyclonal Antibody
ABP58939-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
ABP58939-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
ABP58939-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
A-2729 100 µl
EUR 483.55
Description: Ask the seller for details
ING3 Rabbit pAb
A5832-100ul 100 ul
EUR 308
ING3 Rabbit pAb
A5832-200ul 200 ul
EUR 459
ING3 Rabbit pAb
A5832-20ul 20 ul
EUR 183
ING3 Rabbit pAb
A5832-50ul 50 ul
EUR 223
ING3 antibody
70R-2097 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the N terminal of ING3
ING3 antibody
70R-3052 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the middle region of ING3
ING3 Antibody
ABD2637 100 ug
EUR 438
ING3 Antibody
ABD8079 100 ug
EUR 438
ING3 Antibody
33074-100ul 100ul
EUR 252
ING3 antibody
70R-17970 50 ul
EUR 435
Description: Rabbit polyclonal ING3 antibody
ING3 Antibody
DF8079 200ul
EUR 304
Description: ING3 Antibody detects endogenous levels of total ING3.
ING3 Antibody
1-CSB-PA865171LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200
ING3 Antibody
DF2637 200ul
EUR 304
Description: ING3 antibody detects endogenous levels of total ING3.
ING3 Antibody
1-CSB-PA011714GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
ING3 Conjugated Antibody
C33074 100ul
EUR 397
anti- ING3 antibody
FNab04311 100µg
EUR 548.75
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Gene ID: 54556
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3
ING3-specific Antibody
abx234312-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Anti-ING3 antibody
PAab04311 100 ug
EUR 386
Anti-ING3 antibody
STJ28395 100 µl
EUR 277
Description: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed.
Anti-ING3 antibody
STJ191952 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING3
Ing3/ Rat Ing3 ELISA Kit
ELI-37703r 96 Tests
EUR 886
ING3 siRNA
20-abx902680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ING3 siRNA
20-abx920607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ING3 siRNA
20-abx920608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ING3
YF-PA26262 50 ul
EUR 334
Description: Mouse polyclonal to ING3
anti- ING3-specific antibody
FNab04312 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2400
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3-specific
Anti-p47 ING3 Antibody
A05458 100ug
EUR 432
Description: Goat Polyclonal p47 ING3 Antibody. Validated in WB and tested in Human.
ING3 Antibody, HRP conjugated
1-CSB-PA865171LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ING3 Antibody, FITC conjugated
1-CSB-PA865171LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ING3 Antibody, Biotin conjugated
1-CSB-PA865171LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-ING3-specific antibody
PAab04312 100 ug
EUR 386
ING3 Blocking Peptide
33R-5453 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-3052
ING3 Blocking Peptide
33R-5862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-2097
ING3 cloning plasmid
CSB-CL865171HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 279
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
ING3 cloning plasmid
CSB-CL865171HU2-10ug 10ug
EUR 194
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
ING3 cloning plasmid
CSB-CL865171HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 282
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
ING3 Blocking Peptide
DF8079-BP 1mg
EUR 195
ING3 Blocking Peptide
DF2637-BP 1mg
EUR 195
Anti-ING3 (2E9)
YF-MA18657 50 ug
EUR 363
Description: Mouse monoclonal to ING3
Anti-ING3 (2C4)
YF-MA18659 100 ug
EUR 363
Description: Mouse monoclonal to ING3
Anti-ING3 (2D8)
YF-MA18660 100 ug
EUR 363
Description: Mouse monoclonal to ING3
Mouse ING3 shRNA Plasmid
20-abx977509
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ING3 shRNA Plasmid
20-abx989707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ING3 ELISA KIT|Human
EF010338 96 Tests
EUR 689
Human ING3 shRNA Plasmid
20-abx960134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ING3 Recombinant Protein (Human)
RP016144 100 ug Ask for price
ING3 Recombinant Protein (Human)
RP016147 100 ug Ask for price
ING3 Recombinant Protein (Human)
RP016150 100 ug Ask for price
ING3 Recombinant Protein (Rat)
RP206024 100 ug Ask for price
ING3 Recombinant Protein (Mouse)
RP143831 100 ug Ask for price
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx113134
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
abx146142-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx004471
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx317940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
abx234311-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx225249
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
ING3 ORF Vector (Human) (pORF)
ORF005382 1.0 ug DNA
EUR 95
ING3 ORF Vector (Human) (pORF)
ORF005383 1.0 ug DNA
EUR 95
ING3 ORF Vector (Human) (pORF)
ORF005384 1.0 ug DNA
EUR 95
Ing3 ORF Vector (Rat) (pORF)
ORF068676 1.0 ug DNA
EUR 506
Ing3 ORF Vector (Mouse) (pORF)
ORF047945 1.0 ug DNA
EUR 506
Inhibitor of Growth Protein 3 (ING3) Antibody (HRP)
20-abx314653
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody (FITC)
20-abx314654
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody (Biotin)
20-abx314655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ING3 sgRNA CRISPR Lentivector set (Human)
K1087901 3 x 1.0 ug
EUR 339
Ing3 sgRNA CRISPR Lentivector set (Mouse)
K4032601 3 x 1.0 ug
EUR 339
Ing3 sgRNA CRISPR Lentivector set (Rat)
K7326601 3 x 1.0 ug
EUR 339
ING3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1087902 1.0 ug DNA
EUR 154
ING3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1087903 1.0 ug DNA
EUR 154
ING3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1087904 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4032602 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4032603 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4032604 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7326602 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7326603 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7326604 1.0 ug DNA
EUR 154
ING3 Protein Vector (Human) (pPB-C-His)
PV021525 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021526 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021527 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021528 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-C-His)
PV021529 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021530 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021531 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021532 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-C-His)
PV021533 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021534 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021535 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021536 500 ng
EUR 329
ING3 Protein Vector (Rat) (pPB-C-His)
PV274702 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPB-N-His)
PV274703 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPM-C-HA)
PV274704 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPM-C-His)
PV274705 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPB-C-His)
PV191778 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPB-N-His)
PV191779 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPM-C-HA)
PV191780 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPM-C-His)
PV191781 500 ng
EUR 603
Ing3 3'UTR Luciferase Stable Cell Line
TU206293 1.0 ml Ask for price
Ing3 3'UTR GFP Stable Cell Line
TU160118 1.0 ml Ask for price
ING3 3'UTR Luciferase Stable Cell Line
TU011156 1.0 ml
EUR 2333
Ing3 3'UTR Luciferase Stable Cell Line
TU110118 1.0 ml Ask for price
ING3 3'UTR GFP Stable Cell Line
TU061156 1.0 ml
EUR 2333
Ing3 3'UTR GFP Stable Cell Line
TU256293 1.0 ml Ask for price
ING3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV681787 1.0 ug DNA
EUR 682
ING3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV681791 1.0 ug DNA
EUR 682
ING3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV681792 1.0 ug DNA
EUR 682
ING3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV711459 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV711463 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV711464 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV711465 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV711469 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV711470 1.0 ug DNA
EUR 316
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ING3 Rabbit Polyclonal Antibody