KRT86 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

KRT86 Polyclonal Antibody
ES10729-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KRT86 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
KRT86 Polyclonal Antibody
ABP59084-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein
KRT86 Polyclonal Antibody
ABP59084-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein
KRT86 Polyclonal Antibody
ABP59084-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein
Polyclonal KRT86 Antibody (Center)
APR17130G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KRT86 (Center). This antibody is tested and proven to work in the following applications:
Anti-KRT86 antibody
STJ191887 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KRT86
KRT86 siRNA
20-abx922042
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT86 siRNA
20-abx922043
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT86 cloning plasmid
CSB-CL012581HU-10ug 10ug
EUR 518
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1461
  • Sequence: atgacttgtggatcttactgtggtggccgcgccttcagctgcatctcggcctgcgggccccggcccggccgctgctgcatcaccgccgccccctaccgtggcatctcctgctaccgcggcctcaccgggggcttcggcagccacagcgtgtgcggaggctttcgggccggctcct
  • Show more
Description: A cloning plasmid for the KRT86 gene.
Mouse KRT86 shRNA Plasmid
20-abx971249
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KRT86 shRNA Plasmid
20-abx952638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KRT86 Recombinant Protein (Human)
RP017407 100 ug Ask for price
KRT86 Recombinant Protein (Rat)
RP207677 100 ug Ask for price
KRT86 Recombinant Protein (Mouse)
RP146540 100 ug Ask for price
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx145907-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx031387-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx031387-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
KRT86 ORF Vector (Human) (pORF)
ORF005803 1.0 ug DNA
EUR 95
Krt86 ORF Vector (Rat) (pORF)
ORF069227 1.0 ug DNA
EUR 506
Krt86 ORF Vector (Mouse) (pORF)
ORF048848 1.0 ug DNA
EUR 506
KRT86 sgRNA CRISPR Lentivector set (Human)
K1179201 3 x 1.0 ug
EUR 339
Krt86 sgRNA CRISPR Lentivector set (Mouse)
K3250901 3 x 1.0 ug
EUR 339
Krt86 sgRNA CRISPR Lentivector set (Rat)
K6730601 3 x 1.0 ug
EUR 339
KRT86 sgRNA CRISPR Lentivector (Human) (Target 1)
K1179202 1.0 ug DNA
EUR 154
KRT86 sgRNA CRISPR Lentivector (Human) (Target 2)
K1179203 1.0 ug DNA
EUR 154
KRT86 sgRNA CRISPR Lentivector (Human) (Target 3)
K1179204 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3250902 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3250903 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3250904 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6730602 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6730603 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6730604 1.0 ug DNA
EUR 154
KRT86 Protein Vector (Human) (pPB-C-His)
PV023209 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPB-N-His)
PV023210 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPM-C-HA)
PV023211 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPM-C-His)
PV023212 500 ng
EUR 329
KRT86 Protein Vector (Rat) (pPB-C-His)
PV276906 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPB-N-His)
PV276907 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPM-C-HA)
PV276908 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPM-C-His)
PV276909 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPB-C-His)
PV195390 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPB-N-His)
PV195391 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPM-C-HA)
PV195392 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPM-C-His)
PV195393 500 ng
EUR 603
Krt86 3'UTR Luciferase Stable Cell Line
TU206888 1.0 ml Ask for price
Krt86 3'UTR GFP Stable Cell Line
TU160798 1.0 ml Ask for price
KRT86 3'UTR Luciferase Stable Cell Line
TU012093 1.0 ml
EUR 1394
Krt86 3'UTR Luciferase Stable Cell Line
TU110798 1.0 ml Ask for price
KRT86 3'UTR GFP Stable Cell Line
TU062093 1.0 ml
EUR 1394
Krt86 3'UTR GFP Stable Cell Line
TU256888 1.0 ml Ask for price
KRT86 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV624091 1.0 ug DNA
EUR 682
KRT86 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV624095 1.0 ug DNA
EUR 682
KRT86 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV624096 1.0 ug DNA
EUR 682
Mouse Keratin, type II cuticular Hb6, Krt86 ELISA KIT
ELI-14436m 96 Tests
EUR 865
Human Keratin, type II cuticular Hb6, KRT86 ELISA KIT
ELI-15910h 96 Tests
EUR 824
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

KRT86 Rabbit Polyclonal Antibody