KRT86 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
KRT86 Polyclonal Antibody |
ES10729-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KRT86 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KRT86 Polyclonal Antibody |
ABP59084-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein |
KRT86 Polyclonal Antibody |
ABP59084-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein |
KRT86 Polyclonal Antibody |
ABP59084-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein |
Polyclonal KRT86 Antibody (Center) |
APR17130G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KRT86 (Center). This antibody is tested and proven to work in the following applications: |
Anti-KRT86 antibody |
STJ191887 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KRT86 |
KRT86 siRNA |
20-abx922042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT86 siRNA |
20-abx922043 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT86 cloning plasmid |
CSB-CL012581HU-10ug |
Cusabio |
10ug |
EUR 518 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1461
- Sequence: atgacttgtggatcttactgtggtggccgcgccttcagctgcatctcggcctgcgggccccggcccggccgctgctgcatcaccgccgccccctaccgtggcatctcctgctaccgcggcctcaccgggggcttcggcagccacagcgtgtgcggaggctttcgggccggctcct
- Show more
|
Description: A cloning plasmid for the KRT86 gene. |
Mouse KRT86 shRNA Plasmid |
20-abx971249 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human KRT86 shRNA Plasmid |
20-abx952638 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KRT86 Recombinant Protein (Human) |
RP017407 |
ABM |
100 ug |
Ask for price |
KRT86 Recombinant Protein (Rat) |
RP207677 |
ABM |
100 ug |
Ask for price |
KRT86 Recombinant Protein (Mouse) |
RP146540 |
ABM |
100 ug |
Ask for price |
Keratin, Type II Cuticular Hb6 (KRT86) Antibody |
abx145907-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Keratin, Type II Cuticular Hb6 (KRT86) Antibody |
abx031387-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Keratin, Type II Cuticular Hb6 (KRT86) Antibody |
abx031387-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
KRT86 ORF Vector (Human) (pORF) |
ORF005803 |
ABM |
1.0 ug DNA |
EUR 95 |
Krt86 ORF Vector (Rat) (pORF) |
ORF069227 |
ABM |
1.0 ug DNA |
EUR 506 |
Krt86 ORF Vector (Mouse) (pORF) |
ORF048848 |
ABM |
1.0 ug DNA |
EUR 506 |
KRT86 sgRNA CRISPR Lentivector set (Human) |
K1179201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Krt86 sgRNA CRISPR Lentivector set (Mouse) |
K3250901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Krt86 sgRNA CRISPR Lentivector set (Rat) |
K6730601 |
ABM |
3 x 1.0 ug |
EUR 339 |
KRT86 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1179202 |
ABM |
1.0 ug DNA |
EUR 154 |
KRT86 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1179203 |
ABM |
1.0 ug DNA |
EUR 154 |
KRT86 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1179204 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3250902 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3250903 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3250904 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6730602 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6730603 |
ABM |
1.0 ug DNA |
EUR 154 |
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6730604 |
ABM |
1.0 ug DNA |
EUR 154 |
KRT86 Protein Vector (Human) (pPB-C-His) |
PV023209 |
ABM |
500 ng |
EUR 329 |
KRT86 Protein Vector (Human) (pPB-N-His) |
PV023210 |
ABM |
500 ng |
EUR 329 |
KRT86 Protein Vector (Human) (pPM-C-HA) |
PV023211 |
ABM |
500 ng |
EUR 329 |
KRT86 Protein Vector (Human) (pPM-C-His) |
PV023212 |
ABM |
500 ng |
EUR 329 |
KRT86 Protein Vector (Rat) (pPB-C-His) |
PV276906 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Rat) (pPB-N-His) |
PV276907 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Rat) (pPM-C-HA) |
PV276908 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Rat) (pPM-C-His) |
PV276909 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Mouse) (pPB-C-His) |
PV195390 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Mouse) (pPB-N-His) |
PV195391 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Mouse) (pPM-C-HA) |
PV195392 |
ABM |
500 ng |
EUR 603 |
KRT86 Protein Vector (Mouse) (pPM-C-His) |
PV195393 |
ABM |
500 ng |
EUR 603 |
Krt86 3'UTR Luciferase Stable Cell Line |
TU206888 |
ABM |
1.0 ml |
Ask for price |
Krt86 3'UTR GFP Stable Cell Line |
TU160798 |
ABM |
1.0 ml |
Ask for price |
KRT86 3'UTR Luciferase Stable Cell Line |
TU012093 |
ABM |
1.0 ml |
EUR 1394 |
Krt86 3'UTR Luciferase Stable Cell Line |
TU110798 |
ABM |
1.0 ml |
Ask for price |
KRT86 3'UTR GFP Stable Cell Line |
TU062093 |
ABM |
1.0 ml |
EUR 1394 |
Krt86 3'UTR GFP Stable Cell Line |
TU256888 |
ABM |
1.0 ml |
Ask for price |
KRT86 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV624091 |
ABM |
1.0 ug DNA |
EUR 682 |
KRT86 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV624095 |
ABM |
1.0 ug DNA |
EUR 682 |
KRT86 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV624096 |
ABM |
1.0 ug DNA |
EUR 682 |
Mouse Keratin, type II cuticular Hb6, Krt86 ELISA KIT |
ELI-14436m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Keratin, type II cuticular Hb6, KRT86 ELISA KIT |
ELI-15910h |
Lifescience Market |
96 Tests |
EUR 824 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
KRT86 Rabbit Polyclonal Antibody