MCM8 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

MCM8 Polyclonal Antibody
ES10748-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MCM8 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MCM8 Rabbit pAb
A12922-100ul 100 ul
EUR 308

MCM8 Rabbit pAb
A12922-200ul 200 ul
EUR 459

MCM8 Rabbit pAb
A12922-20ul 20 ul
EUR 183

MCM8 Rabbit pAb
A12922-50ul 50 ul
EUR 223

MCM8 antibody
70R-1607 100 ug
EUR 377
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 antibody
70R-18447 50 ul
EUR 435
Description: Rabbit polyclonal MCM8 antibody

MCM8 Antibody
35812-100ul 100ul
EUR 252

MCM8 Antibody
1-CSB-PA936890
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

MCM8 Antibody
1-CSB-PA890907LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MCM8 Antibody
DF10122 200ul
EUR 304
Description: MCM8 Antibody detects endogenous levels of total MCM8.

MCM8 antibody
70R-51404 100 ul
EUR 244
Description: Purified Polyclonal MCM8 antibody

MCM8 antibody
70R-5551 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 antibody
70R-5553 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the C terminal of MCM8

MCM8 antibody
70R-5605 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 Antibody
1-CSB-PA013598GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MCM8 Antibody
ABD10122 100 ug
EUR 438

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
20-abx007754
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
20-abx005983
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
20-abx214283
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
20-abx113762
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
abx145499-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
abx029507-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
abx029507-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
abx235063-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody
20-abx301806
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Conjugated Antibody
C35812 100ul
EUR 397

anti- MCM8 antibody
FNab05063 100µg
EUR 548.75
  • Immunogen: minichromosome maintenance complex component 8
  • Uniprot ID: Q9UJA3
  • Gene ID: 84515
  • Research Area: Metabolism
Description: Antibody raised against MCM8

Anti-MCM8 antibody
PAab05063 100 ug
EUR 386

Anti-MCM8 Antibody
PB9722 100ug/vial
EUR 294

Anti-MCM8 antibody
STJ114788 100 µl
EUR 277
Description: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-MCM8 antibody
STJ191906 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MCM8

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (HRP)
20-abx315165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (FITC)
20-abx315166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (Biotin)
20-abx315167
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 siRNA
20-abx903191
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCM8 siRNA
20-abx923743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCM8 siRNA
20-abx923744
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCM8 Antibody, HRP conjugated
1-CSB-PA890907LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MCM8 Antibody, FITC conjugated
1-CSB-PA890907LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MCM8 Antibody, Biotin conjugated
1-CSB-PA890907LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MCM8 Blocking Peptide
33R-2568 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5551

MCM8 Blocking Peptide
33R-2569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-1607

MCM8 Blocking Peptide
33R-4137 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5553

MCM8 Blocking Peptide
33R-7902 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5605

MCM8 cloning plasmid
CSB-CL890907HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2523
  • Sequence: atgaatggagagtatagaggcagaggatttggacgaggaagatttcaaagctggaaaaggggaagaggtggtgggaacttctcaggaaaatggagagaaagagaacacagacctgatctgagtaaaaccacaggaaaacgtacttctgaacaaaccccacagtttttgctttcaa
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid
CSB-CL890907HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1812
  • Sequence: atggcttttctttgtgctgcatgtggagaaattcagagctttcctcttccagatggaaaatacagtcttcccacaaagtgtcctgtgcctgtgtgtcgaggcaggtcatttactgctctccgcagctctcctctcacagttacgatggactggcagtcaatcaaaatccaggaat
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid
CSB-CL890907HU3-10ug 10ug
EUR 850
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2643
  • Sequence: ATGAATGGAGAGTATAGAGGCAGAGGATTTGGACGAGGAAGATTTCAAAGCTGGAAAAGGGGAAGAGGTGGTGGGAACTTCTCAGGAAAATGGAGAGAAAGAGAACACAGACCTGATCTGAGTAAAACCACAGGAAAACGTACTTCTGAACAAACCCCACAGTTTTTGCTTTCAA
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 Blocking Peptide
DF10122-BP 1mg
EUR 195

MCM8 Blocking Peptide
20-abx064279
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-MCM8 (1F9)
YF-MA19553 100 ug
EUR 363
Description: Mouse monoclonal to MCM8

Human DNA replication licensing factor MCM8, MCM8 ELISA KIT
ELI-20539h 96 Tests
EUR 824

Human MCM8 Minichromosome Maintenance Deficient 8 (MCM8) ELISA Kit
abx381378-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse DNA replication licensing factor MCM8, Mcm8 ELISA KIT
ELI-38435m 96 Tests
EUR 865

MCM8 ELISA KIT|Human
EF000701 96 Tests
EUR 689

Rat MCM8 shRNA Plasmid
20-abx988790
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MCM8 shRNA Plasmid
20-abx975714
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MCM8 shRNA Plasmid
20-abx963500
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mcm8 ORF Vector (Rat) (pORF)
ORF070381 1.0 ug DNA
EUR 506

MCM8 ORF Vector (Human) (pORF)
ORF006337 1.0 ug DNA
EUR 95

MCM8 ORF Vector (Human) (pORF)
ORF006338 1.0 ug DNA
EUR 95

MCM8 ORF Vector (Human) (pORF)
ORF013763 1.0 ug DNA
EUR 354

Mcm8 ORF Vector (Mouse) (pORF)
ORF049949 1.0 ug DNA
EUR 506

Mcm8 sgRNA CRISPR Lentivector set (Mouse)
K4789101 3 x 1.0 ug
EUR 339

Mcm8 sgRNA CRISPR Lentivector set (Rat)
K6535701 3 x 1.0 ug
EUR 339

MCM8 sgRNA CRISPR Lentivector set (Human)
K1280901 3 x 1.0 ug
EUR 339

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4789102 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4789103 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4789104 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6535702 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6535703 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6535704 1.0 ug DNA
EUR 154

MCM8 sgRNA CRISPR Lentivector (Human) (Target 1)
K1280902 1.0 ug DNA
EUR 154

MCM8 sgRNA CRISPR Lentivector (Human) (Target 2)
K1280903 1.0 ug DNA
EUR 154

MCM8 sgRNA CRISPR Lentivector (Human) (Target 3)
K1280904 1.0 ug DNA
EUR 154

MCM8 Protein Vector (Rat) (pPB-C-His)
PV281522 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPB-N-His)
PV281523 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPM-C-HA)
PV281524 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPM-C-His)
PV281525 500 ng
EUR 1166

MCM8 Protein Vector (Mouse) (pPB-C-His)
PV199794 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPB-N-His)
PV199795 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPM-C-HA)
PV199796 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPM-C-His)
PV199797 500 ng
EUR 1065

MCM8 Protein Vector (Human) (pPB-C-His)
PV055049 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPB-N-His)
PV055050 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPM-C-HA)
PV055051 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPM-C-His)
PV055052 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPB-C-His)
PV025345 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-N-His)
PV025346 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-HA)
PV025347 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-His)
PV025348 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-C-His)
PV025349 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-N-His)
PV025350 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-HA)
PV025351 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-His)
PV025352 500 ng
EUR 329

Mcm8 3'UTR Luciferase Stable Cell Line
TU113002 1.0 ml Ask for price

Mcm8 3'UTR GFP Stable Cell Line
TU163002 1.0 ml Ask for price

Mcm8 3'UTR Luciferase Stable Cell Line
TU212968 1.0 ml Ask for price

Mcm8 3'UTR GFP Stable Cell Line
TU262968 1.0 ml Ask for price

MCM8 3'UTR GFP Stable Cell Line
TU063129 1.0 ml
EUR 1394

MCM8 3'UTR Luciferase Stable Cell Line
TU013129 1.0 ml
EUR 1394

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV712227 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV712231 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV712232 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV712233 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV712237 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV712238 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704223 1.0 ug DNA
EUR 450

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704227 1.0 ug DNA
EUR 450

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704228 1.0 ug DNA
EUR 450

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

MCM8 Rabbit Polyclonal Antibody