NEK2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
NEK2 Polyclonal Antibody |
ABP59442-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NEK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NEK2 from Human. This NEK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK2 protein |
NEK2 Polyclonal Antibody |
ABP59442-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NEK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NEK2 from Human. This NEK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK2 protein |
NEK2 Rabbit pAb |
A5355-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK2 Rabbit pAb |
A5355-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK2 Rabbit pAb |
A5355-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK2 Rabbit pAb |
A5355-50ul |
Abclonal |
50 ul |
EUR 223 |
NEK2 Rabbit pAb |
A13334-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK2 Rabbit pAb |
A13334-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK2 Rabbit pAb |
A13334-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK2 Rabbit pAb |
A13334-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NEK2 Antibody (Center) |
APR06062G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (Center). This antibody is tested and proven to work in the following applications: |
NEK2 Antibody |
AF7557 |
Affbiotech |
200ul |
EUR 376 |
Description: NEK2 Antibody detects endogenous levels of NEK2. |
NEK2 Antibody |
32795-100ul |
SAB |
100ul |
EUR 252 |
NEK2 antibody |
70R-18839 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NEK2 antibody |
NEK2 Antibody |
DF7296 |
Affbiotech |
200ul |
EUR 304 |
Description: NEK2 Antibody detects endogenous levels of total NEK2. |
NEK2 Antibody |
DF2669 |
Affbiotech |
200ul |
EUR 304 |
Description: NEK2 antibody detects endogenous levels of total NEK2. |
NEK2 Antibody |
1-CSB-PA295415 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
NEK2 Antibody |
1-CSB-PA015699ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NEK2 Antibody |
1-CSB-PA015699GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal NEK2 Antibody (aa287-299) |
APR02189G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (aa287-299). This antibody is tested and proven to work in the following applications: |
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx142097 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx146251-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx033852-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx033852-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx025140-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx025140-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx004096 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx320236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx235651-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx235652-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx213477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK2 (Phospho-Ser170) Polyclonal Conjugated Antibody |
C12922 |
SAB |
100ul |
EUR 397 |
NEK2 Conjugated Antibody |
C32795 |
SAB |
100ul |
EUR 397 |
anti- NEK2 antibody |
FNab05651 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: NIMA (never in mitosis gene a)-related kinase 2
- Uniprot ID: P51955
- Gene ID: 4751
- Research Area: Metabolism
|
Description: Antibody raised against NEK2 |
anti- NEK2 antibody |
FNab05652 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: NIMA(never in mitosis gene a)-related kinase 2
- Uniprot ID: P51955
- Research Area: Metabolism
|
Description: Antibody raised against NEK2 |
Anti-NEK2 Antibody |
A01606 |
BosterBio |
100ug |
EUR 432 |
Description: Rabbit Polyclonal NEK2 Antibody. Validated in WB and tested in Human. |
Anti-NEK2 antibody |
STJ27308 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. |
Anti-NEK2 antibody |
STJ115297 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. |
Anti-NEK2 antibody |
STJ191974 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NEK2 |
NEK2 siRNA |
20-abx925714 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK2 siRNA |
20-abx925715 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK2 protein |
30R-2834 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human NEK2 protein |
anti-NEK2 |
YF-PA13411 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NEK2 |
anti-NEK2 |
YF-PA13412 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NEK2 |
anti-NEK2 |
YF-PA13413 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to NEK2 |
anti-NEK2 |
YF-PA13414 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NEK2 |
Phospho-NEK2(Ser170) Antibody |
AF7057 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-NEK2(Ser170) Antibody detects endogenous levels of NEK2 only when phosphorylated at Ser170. |
NEK2 (Phospho-Ser170) Antibody |
12922-100ul |
SAB |
100ul |
EUR 252 |
NEK2 (Phospho-Ser170) Antibody |
12922-50ul |
SAB |
50ul |
EUR 187 |
NEK2 Blocking Peptide |
AF7557-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 cloning plasmid |
CSB-CL015699HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 645
- Sequence: atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgct
- Show more
|
Description: A cloning plasmid for the NEK2 gene. |
NEK2 Blocking Peptide |
DF7296-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 Blocking Peptide |
DF2669-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-NEK2 (2F9) |
YF-MA14408 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (2A10) |
YF-MA14409 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (1C8) |
YF-MA14410 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (3B7) |
YF-MA14411 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (2F6) |
YF-MA10616 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Human NEK2(Serine/threonine-protein kinase Nek2) ELISA Kit |
EH4130 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P51955
- Alias: HSPK 21/Never in mitosis A-related kinase 2/NimA-related protein kinase 2/NimA-like protein kinase 1/NEK2A/NLK1
|
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Serine/threonine- protein kinase Nek2, NEK2 ELISA KIT |
ELI-36500h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Serine/threonine- protein kinase Nek2, Nek2 ELISA KIT |
ELI-42481m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Serine, threonine-protein kinase Nek2 (NEK2) ELISA Kit |
abx257267-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human NEK2 shRNA Plasmid |
20-abx953154 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NEK2 shRNA Plasmid |
20-abx971710 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal NEK2 Antibody (clone 2F6), Clone: 2F6 |
AMM02013G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human NEK2 (clone 2F6). The antibodies are raised in Mouse and are from clone 2F6. This antibody is applicable in WB and IHC-P, E, IP |
Monoclonal NEK2 Antibody (monoclonal) (M02), Clone: 2F9 |
AMM03848G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2F9. This antibody is applicable in WB and IF, E |
Monoclonal NEK2 Antibody (monoclonal) (M11), Clone: 3B7 |
AMM03849G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 3B7. This antibody is applicable in WB and IF |
Phospho-NEK2(Ser170) Blocking Peptide |
AF7057-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 ORF Vector (Human) (pORF) |
ORF007021 |
ABM |
1.0 ug DNA |
EUR 95 |
Nek2 ORF Vector (Rat) (pORF) |
ORF071223 |
ABM |
1.0 ug DNA |
EUR 506 |
Nek2 ORF Vector (Mouse) (pORF) |
ORF051217 |
ABM |
1.0 ug DNA |
EUR 506 |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human) |
4-PAH562Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2) |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat) |
4-PAH562Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2) |
NEK2 sgRNA CRISPR Lentivector set (Human) |
K1416301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nek2 sgRNA CRISPR Lentivector set (Mouse) |
K3830001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nek2 sgRNA CRISPR Lentivector set (Rat) |
K7102501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC |
4-PAH562Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Biotinylated |
4-PAH562Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Cy3 |
4-PAH562Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), FITC |
4-PAH562Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), HRP |
4-PAH562Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), PE |
4-PAH562Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC |
4-PAH562Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Biotinylated |
4-PAH562Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Cy3 |
4-PAH562Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), FITC |
4-PAH562Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), HRP |
4-PAH562Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), PE |
4-PAH562Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH562Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Lys125~Asn393)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAH562Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2) |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAH562Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Val137~Glu400)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7. |
NEK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1416302 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1416303 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1416304 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3830002 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3830003 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3830004 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7102502 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7102503 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7102504 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK2 Protein Vector (Rat) (pPB-C-His) |
PV284890 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Rat) (pPB-N-His) |
PV284891 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Rat) (pPM-C-HA) |
PV284892 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Rat) (pPM-C-His) |
PV284893 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Human) (pPB-C-His) |
PV028081 |
ABM |
500 ng |
EUR 329 |
NEK2 Protein Vector (Human) (pPB-N-His) |
PV028082 |
ABM |
500 ng |
EUR 329 |
NEK2 Protein Vector (Human) (pPM-C-HA) |
PV028083 |
ABM |
500 ng |
EUR 329 |
NEK2 Protein Vector (Human) (pPM-C-His) |
PV028084 |
ABM |
500 ng |
EUR 329 |
NEK2 Protein Vector (Mouse) (pPB-C-His) |
PV204866 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Mouse) (pPB-N-His) |
PV204867 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Mouse) (pPM-C-HA) |
PV204868 |
ABM |
500 ng |
EUR 603 |
NEK2 Protein Vector (Mouse) (pPM-C-His) |
PV204869 |
ABM |
500 ng |
EUR 603 |
Nek2 3'UTR GFP Stable Cell Line |
TU163986 |
ABM |
1.0 ml |
Ask for price |
Nek2 3'UTR Luciferase Stable Cell Line |
TU213883 |
ABM |
1.0 ml |
Ask for price |
NEK2 3'UTR Luciferase Stable Cell Line |
TU015566 |
ABM |
1.0 ml |
EUR 1394 |
Nek2 3'UTR Luciferase Stable Cell Line |
TU113986 |
ABM |
1.0 ml |
Ask for price |
NEK2 3'UTR GFP Stable Cell Line |
TU065566 |
ABM |
1.0 ml |
EUR 1394 |
Nek2 3'UTR GFP Stable Cell Line |
TU263883 |
ABM |
1.0 ml |
Ask for price |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody |
20-abx128042 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody |
20-abx104136 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody |
20-abx104137 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAH562Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAH562Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAH562Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAH562Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAH562Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP. |
Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAH562Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NEK2 (Phe148~Glu397)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NEK2 Rabbit Polyclonal Antibody