NEK2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

NEK2 Polyclonal Antibody

ABP59442-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NEK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEK2 from Human. This NEK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK2 protein

NEK2 Polyclonal Antibody

ABP59442-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NEK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEK2 from Human. This NEK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK2 protein

NEK2 Rabbit pAb

A5355-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A5355-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A5355-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A5355-50ul 50 ul
EUR 223

NEK2 Rabbit pAb

A13334-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A13334-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A13334-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A13334-50ul 50 ul
EUR 223

Polyclonal NEK2 Antibody (Center)

APR06062G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (Center). This antibody is tested and proven to work in the following applications:

NEK2 Antibody

AF7557 200ul
EUR 376
Description: NEK2 Antibody detects endogenous levels of NEK2.

NEK2 Antibody

ABD2669 100 ug
EUR 438

NEK2 Antibody

ABD7296 100 ug
EUR 438

NEK2 Antibody

32795-100ul 100ul
EUR 252

NEK2 antibody

70R-18839 50 ul
EUR 435
Description: Rabbit polyclonal NEK2 antibody

NEK2 Antibody

DF7296 200ul
EUR 304
Description: NEK2 Antibody detects endogenous levels of total NEK2.

NEK2 Antibody

DF2669 200ul
EUR 304
Description: NEK2 antibody detects endogenous levels of total NEK2.

NEK2 Antibody

1-CSB-PA295415
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NEK2 Antibody

1-CSB-PA015699ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NEK2 Antibody

1-CSB-PA015699GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal NEK2 Antibody (aa287-299)

APR02189G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (aa287-299). This antibody is tested and proven to work in the following applications:

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx142097
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx146251-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx004096
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx320236
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235651-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx213477
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NEK2 (Phospho-Ser170) Polyclonal Conjugated Antibody

C12922 100ul
EUR 397

NEK2 Conjugated Antibody

C32795 100ul
EUR 397

anti- NEK2 antibody

FNab05651 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: NIMA (never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Gene ID: 4751
  • Research Area: Metabolism
Description: Antibody raised against NEK2

anti- NEK2 antibody

FNab05652 100µg
EUR 548.75
  • Immunogen: NIMA(never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Research Area: Metabolism
Description: Antibody raised against NEK2

Anti-NEK2 Antibody

A01606 100ug
EUR 432
Description: Rabbit Polyclonal NEK2 Antibody. Validated in WB and tested in Human.

Anti-NEK2 antibody

PAab05651 100 ug
EUR 386

Anti-NEK2 antibody

PAab05652 100 ug
EUR 386

Anti-NEK2 antibody

STJ27308 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ115297 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ191974 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK2

NEK2 siRNA

20-abx925714
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK2 siRNA

20-abx925715
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK2, Active

7719-5
EUR 370

NEK2 protein

30R-2834 5 ug
EUR 503
Description: Purified recombinant Human NEK2 protein

anti-NEK2

YF-PA13411 50 ul
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13412 50 ug
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13413 100 ul
EUR 403
Description: Rabbit polyclonal to NEK2

anti-NEK2

YF-PA13414 100 ug
EUR 403
Description: Rabbit polyclonal to NEK2

Phospho-NEK2(Ser170) Antibody

AF7057 200ul
EUR 376
Description: Phospho-NEK2(Ser170) Antibody detects endogenous levels of NEK2 only when phosphorylated at Ser170.

NEK2 (Phospho-Ser170) Antibody

12922-100ul 100ul
EUR 252

NEK2 (Phospho-Ser170) Antibody

12922-50ul 50ul
EUR 187

NEK2 Blocking Peptide

AF7557-BP 1mg
EUR 195

NEK2 cloning plasmid

CSB-CL015699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgct
  • Show more
Description: A cloning plasmid for the NEK2 gene.

NEK2 Blocking Peptide

DF7296-BP 1mg
EUR 195

NEK2 Blocking Peptide

DF2669-BP 1mg
EUR 195

Anti-NEK2 (2F9)

YF-MA14408 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2A10)

YF-MA14409 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (1C8)

YF-MA14410 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (3B7)

YF-MA14411 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2F6)

YF-MA10616 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Human NEK2(Serine/threonine-protein kinase Nek2) ELISA Kit

EH4130 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51955
  • Alias: HSPK 21/Never in mitosis A-related kinase 2/NimA-related protein kinase 2/NimA-like protein kinase 1/NEK2A/NLK1
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Serine/threonine- protein kinase Nek2, NEK2 ELISA KIT

ELI-36500h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase Nek2, Nek2 ELISA KIT

ELI-42481m 96 Tests
EUR 865

Human Serine, threonine-protein kinase Nek2 (NEK2) ELISA Kit

abx257267-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

NEK2 ELISA KIT|Human

EF007336 96 Tests
EUR 689

Human NEK2 shRNA Plasmid

20-abx953154
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NEK2 shRNA Plasmid

20-abx971710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal NEK2 Antibody (clone 2F6), Clone: 2F6

AMM02013G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NEK2 (clone 2F6). The antibodies are raised in Mouse and are from clone 2F6. This antibody is applicable in WB and IHC-P, E, IP

Monoclonal NEK2 Antibody (monoclonal) (M02), Clone: 2F9

AMM03848G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2F9. This antibody is applicable in WB and IF, E

Monoclonal NEK2 Antibody (monoclonal) (M11), Clone: 3B7

AMM03849G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 3B7. This antibody is applicable in WB and IF

Phospho-NEK2(Ser170) Blocking Peptide

AF7057-BP 1mg
EUR 195

NEK2 ORF Vector (Human) (pORF)

ORF007021 1.0 ug DNA
EUR 95

Nek2 ORF Vector (Rat) (pORF)

ORF071223 1.0 ug DNA
EUR 506

Nek2 ORF Vector (Mouse) (pORF)

ORF051217 1.0 ug DNA
EUR 506

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human)

4-PAH562Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2)

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat)

4-PAH562Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2)

NEK2 sgRNA CRISPR Lentivector set (Human)

K1416301 3 x 1.0 ug
EUR 339

Nek2 sgRNA CRISPR Lentivector set (Mouse)

K3830001 3 x 1.0 ug
EUR 339

Nek2 sgRNA CRISPR Lentivector set (Rat)

K7102501 3 x 1.0 ug
EUR 339

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC

4-PAH562Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Biotinylated

4-PAH562Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Cy3

4-PAH562Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), FITC

4-PAH562Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), HRP

4-PAH562Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), PE

4-PAH562Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC

4-PAH562Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Biotinylated

4-PAH562Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Cy3

4-PAH562Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), FITC

4-PAH562Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), HRP

4-PAH562Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), PE

4-PAH562Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC-Cy7

4-PAH562Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat)

4-PAH562Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2)

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC-Cy7

4-PAH562Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7.

NEK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416302 1.0 ug DNA
EUR 154

NEK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416303 1.0 ug DNA
EUR 154

NEK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416304 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3830002 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3830003 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3830004 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7102502 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7102503 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7102504 1.0 ug DNA
EUR 154

NEK2 Protein Vector (Rat) (pPB-C-His)

PV284890 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPB-N-His)

PV284891 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPM-C-HA)

PV284892 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPM-C-His)

PV284893 500 ng
EUR 603

NEK2 Protein Vector (Human) (pPB-C-His)

PV028081 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPB-N-His)

PV028082 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPM-C-HA)

PV028083 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPM-C-His)

PV028084 500 ng
EUR 329

NEK2 Protein Vector (Mouse) (pPB-C-His)

PV204866 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPB-N-His)

PV204867 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPM-C-HA)

PV204868 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPM-C-His)

PV204869 500 ng
EUR 603

Nek2 3'UTR GFP Stable Cell Line

TU163986 1.0 ml Ask for price

Nek2 3'UTR Luciferase Stable Cell Line

TU213883 1.0 ml Ask for price

NEK2 3'UTR Luciferase Stable Cell Line

TU015566 1.0 ml
EUR 1394

Nek2 3'UTR Luciferase Stable Cell Line

TU113986 1.0 ml Ask for price

NEK2 3'UTR GFP Stable Cell Line

TU065566 1.0 ml
EUR 1394

Nek2 3'UTR GFP Stable Cell Line

TU263883 1.0 ml Ask for price

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx128042
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx104136
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx104137
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAH562Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAH562Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAH562Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAH562Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAH562Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAH562Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NEK2 Rabbit Polyclonal Antibody