PLCB4 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

PLCB4 Polyclonal Antibody

ABP59934-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein

PLCB4 Polyclonal Antibody

ES10734-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLCB4 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLCB4 Polyclonal Antibody

ES10734-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLCB4 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLCB4 Antibody

44841-100ul 100ul
EUR 252

PLCB4 Antibody

44841-50ul 50ul
EUR 187

PLCB4 Antibody

DF2564 200ul
EUR 304
Description: PLCB4 antibody detects endogenous levels of total PLCB4.

PLCB4 antibody

70R-35323 100 ug
EUR 349
Description: Purified Rabbit polyclonal PLCB4 antibody

PLCB4 Antibody

ABD2564 100 ug
EUR 438

Plcb4/ Rat Plcb4 ELISA Kit

ELI-45330r 96 Tests
EUR 886

PLCB4 Conjugated Antibody

C44841 100ul
EUR 397

Anti-PLCB4 antibody

STJ191892 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLCB4

PLCB4 siRNA

20-abx928838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLCB4 siRNA

20-abx928839
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human)

4-PAD836Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4)

PLCB4 Blocking Peptide

DF2564-BP 1mg
EUR 195

PLCB4 cloning plasmid

CSB-CL614882HU-10ug 10ug
EUR 1249
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3528
  • Sequence: atggccaaaccttatgaatttaactggcagaaggaagttccctcctttttgcaagaaggaacagtttttgacagatacgaggaggaatcctttgtgtttgaacccaactgcctcttcaaagtggatgagtttggcttctttctgacatggagaagtgaaggcaaggaaggacagg
  • Show more
Description: A cloning plasmid for the PLCB4 gene.

Recombinant human PLCB4

P1005 100ug Ask for price
  • Uniprot ID: Q15147
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PLCB4

pCR4-TOPO-PLCB4

PVT14470 2 ug
EUR 495

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC

4-PAD836Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Biotinylated

4-PAD836Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Biotin.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Cy3

4-PAD836Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Cy3.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), FITC

4-PAD836Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with FITC.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), HRP

4-PAD836Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with HRP.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), PE

4-PAD836Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with PE.

Bovine PLCB4 ELISA KIT

ELI-15225b 96 Tests
EUR 928

Human PLCB4 ELISA KIT

ELI-15380h 96 Tests
EUR 824

Rat PLCB4 shRNA Plasmid

20-abx984749
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PLCB4 shRNA Plasmid

20-abx953572
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospholipase C Beta 4 (PLCB4) Antibody

20-abx219523
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCB4) Antibody

abx037229-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCb4) Antibody

20-abx131466
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC-Cy7

4-PAD836Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC-Cy7.

Plcb4 ORF Vector (Rat) (pORF)

ORF073612 1.0 ug DNA
EUR 506

PLCB4 ORF Vector (Human) (pORF)

ORF014093 1.0 ug DNA
EUR 354

Plcb4 ORF Vector (Mouse) (pORF)

ORF054214 1.0 ug DNA
EUR 506

Plcb4 sgRNA CRISPR Lentivector set (Rat)

K6820901 3 x 1.0 ug
EUR 339

Plcb4 sgRNA CRISPR Lentivector set (Mouse)

K3395901 3 x 1.0 ug
EUR 339

PLCB4 sgRNA CRISPR Lentivector set (Human)

K1662701 3 x 1.0 ug
EUR 339

Recombinant Phospholipase C Beta 4 (PLCb4)

4-RPD836Hu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15147
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Phospholipase C Beta 4 expressed in: E.coli

Human Phospholipase C Beta 4 (PLCb4) Protein

20-abx650490
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6820902 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6820903 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6820904 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3395902 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3395903 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3395904 1.0 ug DNA
EUR 154

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1662702 1.0 ug DNA
EUR 154

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1662703 1.0 ug DNA
EUR 154

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1662704 1.0 ug DNA
EUR 154

PLCB4 Protein Vector (Rat) (pPB-C-His)

PV294446 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPB-N-His)

PV294447 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPM-C-HA)

PV294448 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPM-C-His)

PV294449 500 ng
EUR 1191

PLCB4 Protein Vector (Human) (pPB-C-His)

PV056369 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPB-N-His)

PV056370 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPM-C-HA)

PV056371 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPM-C-His)

PV056372 500 ng
EUR 481

PLCB4 Protein Vector (Mouse) (pPB-C-His)

PV216854 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPB-N-His)

PV216855 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPM-C-HA)

PV216856 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPM-C-His)

PV216857 500 ng
EUR 1065

Plcb4 3'UTR Luciferase Stable Cell Line

TU116499 1.0 ml Ask for price

Plcb4 3'UTR GFP Stable Cell Line

TU166499 1.0 ml Ask for price

Plcb4 3'UTR Luciferase Stable Cell Line

TU216359 1.0 ml Ask for price

Plcb4 3'UTR GFP Stable Cell Line

TU266359 1.0 ml Ask for price

PLCB4 3'UTR GFP Stable Cell Line

TU068208 1.0 ml
EUR 1521

PLCB4 3'UTR Luciferase Stable Cell Line

TU018208 1.0 ml
EUR 1521

PLCB4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV680863 1.0 ug DNA
EUR 1355

PLCB4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV680867 1.0 ug DNA
EUR 1355

PLCB4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV680868 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

PLCB4 Rabbit Polyclonal Antibody