RAD1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

RAD1 Polyclonal Antibody
ABP60078-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAD1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAD1 from Human, Mouse. This RAD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAD1 protein
RAD1 Polyclonal Antibody
ABP60078-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAD1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAD1 from Human, Mouse. This RAD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAD1 protein
RAD1 Polyclonal Antibody
ES10563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAD1 Polyclonal Antibody
ES10563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAD1 Rabbit pAb
A1047-100ul 100 ul
EUR 308
RAD1 Rabbit pAb
A1047-200ul 200 ul
EUR 459
RAD1 Rabbit pAb
A1047-20ul 20 ul
EUR 183
RAD1 Rabbit pAb
A1047-50ul 50 ul
EUR 223
RAD1 Rabbit pAb
A6841-100ul 100 ul
EUR 308
RAD1 Rabbit pAb
A6841-200ul 200 ul
EUR 459
RAD1 Rabbit pAb
A6841-20ul 20 ul
EUR 183
RAD1 Rabbit pAb
A6841-50ul 50 ul
EUR 223
Rad1 antibody
22948-100ul 100ul
EUR 390
RAD1 antibody
70R-12488 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RAD1 antibody
RAD1 antibody
70R-19742 50 ul
EUR 435
Description: Rabbit polyclonal RAD1 antibody
RAD1 antibody
38168-100ul 100ul
EUR 252
RAD1 Antibody
DF6196 200ul
EUR 304
Description: RAD1 Antibody detects endogenous levels of total RAD1.
RAD1 Antibody
DF2364 200ul
EUR 304
Description: RAD1 antibody detects endogenous levels of total RAD1.
RAD1 antibody
70R-9526 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAD1 antibody
RAD1 antibody
70R-51320 100 ul
EUR 244
Description: Purified Polyclonal RAD1 antibody
RAD1 Antibody
1-CSB-PA019252ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAD1. Recognizes RAD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200
RAD1 Antibody
1-CSB-PA019252GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD1. Recognizes RAD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
RAD1 Antibody
ABD2364 100 ug
EUR 438
RAD1 Antibody
ABD6196 100 ug
EUR 438
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
20-abx007833
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
20-abx123204
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
abx146461-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
abx028531-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
abx028531-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
20-abx321448
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
abx237073-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody
20-abx000974
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E04C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E04C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E04C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
RAD1 Conjugated Antibody
C38168 100ul
EUR 397
anti- RAD1 antibody
FNab07073 100µg
EUR 505.25
  • Immunogen: RAD1 homolog(S. pombe)
  • Uniprot ID: O60671
  • Gene ID: 5810
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against RAD1
Anti-RAD1 antibody
PAab07073 100 ug
EUR 355
Anti-RAD1 antibody
STJ26167 100 µl
EUR 277
Description: This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described.
Anti-RAD1 antibody
STJ116309 100 µl
EUR 277
Description: This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described.
Anti-RAD1 Antibody
STJ193200 200 µl
EUR 197
Anti-RAD1 antibody
STJ191721 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAD1
RAD1 Checkpoint DNA Exonuclease (RAD1) Protein
20-abx262902
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human RAD1 Homolog(RAD1)ELISA Kit
QY-E04672 96T
EUR 361
RAD1 siRNA
20-abx930759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAD1 siRNA
20-abx930760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-Rad1
YF-PA14224 50 ug
EUR 363
Description: Mouse polyclonal to Rad1
anti-Rad1
YF-PA14225 100 ug
EUR 403
Description: Rabbit polyclonal to Rad1
Human Cell cycle checkpoint protein RAD1 (RAD1)
1-CSB-EP019252HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 58.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cell cycle checkpoint protein RAD1(RAD1) expressed in E.coli
Human RAD1 Checkpoint DNA Exonuclease (RAD1) ELISA Kit
abx382654-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Recombinant Human RAD1
7-06046 2µg Ask for price
Recombinant Human RAD1
7-06047 10µg Ask for price
Recombinant Human RAD1
7-06048 1mg Ask for price
RAD1 Blocking Peptide
33R-4182 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD1 antibody, catalog no. 70R-9526
RAD1 Blocking Peptide
DF6196-BP 1mg
EUR 195
RAD1 Blocking Peptide
DF2364-BP 1mg
EUR 195
RAD1 Blocking Peptide
20-abx064195
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RAD1 cloning plasmid
CSB-CL019252HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atgccccttctgacccaacagatccaagacgaggatgatcagtacagccttgtggccagccttgacaacgttaggaatctctccactatcttgaaagctattcatttccgagaacatgccacgtgtttcgcaactaaaaatggtatcaaagtaacagtggaaaatgcaaagtgtgt
  • Show more
Description: A cloning plasmid for the RAD1 gene.
pCMV-SPORT6-RAD1
PVT12557 2 ug
EUR 391
Anti-Rad1 (1G2)
YF-MA10758 100 ug
EUR 363
Description: Mouse monoclonal to Rad1
Anti-Rad1 (1G2)
YF-MA15063 100 ug
EUR 363
Description: Mouse monoclonal to Rad1
Anti-Rad1 (1A12)
YF-MA15064 100 ug
EUR 363
Description: Mouse monoclonal to Rad1
Anti-RAD1 (1G2)
YF-MA20407 200 ul
EUR 363
Description: Mouse monoclonal to RAD1
Rad1 Homolog (S. Pombe) Antibody
20-abx115011
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E02C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E02C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E02C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E01C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E01C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E01C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E03C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E03C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E03C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E06C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E06C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E06C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E09C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E09C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E09C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E08C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E08C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E08C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E07C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E07C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E07C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cell cycle checkpoint protein RAD1, RAD1 ELISA KIT
ELI-14922h 96 Tests
EUR 824
Mouse Cell cycle checkpoint protein RAD1, Rad1 ELISA KIT
ELI-18200m 96 Tests
EUR 865
Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E05C2412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E05C2412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit
E05C2412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
RAD1 protein (His tag)
80R-1407 50 ug
EUR 397
Description: Purified recombinant Human RAD1 protein
RAD1 ELISA KIT|Human
EF002279 96 Tests
EUR 689
Mouse RAD1 shRNA Plasmid
20-abx972358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RAD1 shRNA Plasmid
20-abx953928
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RAD1 Human Recombinant Protein
PROTO60671 Regular: 10ug
EUR 317
Description: RAD1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (1-282 a.a.) and having a molecular mass of 33.9 kDa. The RAD1 is fused to 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.
RAD1 Recombinant Protein (Human)
RP025618 100 ug Ask for price
RAD1 Recombinant Protein (Mouse)
RP166460 100 ug Ask for price
RAD1 Recombinant Protein (Rat)
RP223454 100 ug Ask for price
Rad1 ORF Vector (Rat) (pORF)
ORF074486 1.0 ug DNA
EUR 506
RAD1 ORF Vector (Human) (pORF)
ORF008540 1.0 ug DNA
EUR 95
Rad1 ORF Vector (Mouse) (pORF)
ORF055488 1.0 ug DNA
EUR 506
Rad1 sgRNA CRISPR Lentivector set (Mouse)
K4981501 3 x 1.0 ug
EUR 339
Rad1 sgRNA CRISPR Lentivector set (Rat)
K6411301 3 x 1.0 ug
EUR 339
RAD1 sgRNA CRISPR Lentivector set (Human)
K1777901 3 x 1.0 ug
EUR 339
Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4981502 1.0 ug DNA
EUR 154
Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4981503 1.0 ug DNA
EUR 154
Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4981504 1.0 ug DNA
EUR 154
Rad1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6411302 1.0 ug DNA
EUR 154
Rad1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6411303 1.0 ug DNA
EUR 154
Rad1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6411304 1.0 ug DNA
EUR 154
RAD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1777902 1.0 ug DNA
EUR 154
RAD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1777903 1.0 ug DNA
EUR 154
RAD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1777904 1.0 ug DNA
EUR 154
RAD1 Protein Vector (Rat) (pPB-C-His)
PV297942 500 ng
EUR 603
RAD1 Protein Vector (Rat) (pPB-N-His)
PV297943 500 ng
EUR 603
RAD1 Protein Vector (Rat) (pPM-C-HA)
PV297944 500 ng
EUR 603
RAD1 Protein Vector (Rat) (pPM-C-His)
PV297945 500 ng
EUR 603
RAD1 Protein Vector (Human) (pPB-C-His)
PV034157 500 ng
EUR 329
RAD1 Protein Vector (Human) (pPB-N-His)
PV034158 500 ng
EUR 329
RAD1 Protein Vector (Human) (pPM-C-HA)
PV034159 500 ng
EUR 329
RAD1 Protein Vector (Human) (pPM-C-His)
PV034160 500 ng
EUR 329
RAD1 Protein Vector (Mouse) (pPB-C-His)
PV221950 500 ng
EUR 603
RAD1 Protein Vector (Mouse) (pPB-N-His)
PV221951 500 ng
EUR 603
RAD1 Protein Vector (Mouse) (pPM-C-HA)
PV221952 500 ng
EUR 603
RAD1 Protein Vector (Mouse) (pPM-C-His)
PV221953 500 ng
EUR 603
Rad1 3'UTR Luciferase Stable Cell Line
TU117464 1.0 ml Ask for price
Rad1 3'UTR GFP Stable Cell Line
TU167464 1.0 ml Ask for price
Rad1 3'UTR Luciferase Stable Cell Line
TU217244 1.0 ml Ask for price
Rad1 3'UTR GFP Stable Cell Line
TU267244 1.0 ml Ask for price
RAD1 3'UTR GFP Stable Cell Line
TU069429 1.0 ml
EUR 2333
RAD1 3'UTR Luciferase Stable Cell Line
TU019429 1.0 ml
EUR 2333
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

RAD1 Rabbit Polyclonal Antibody