RIPK1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

RIPK1 Polyclonal Antibody

ABP60179-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1 Polyclonal Antibody

ES10796-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Polyclonal Antibody

ES10796-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Rabbit pAb

A7414-100ul 100 ul
EUR 308

RIPK1 Rabbit pAb

A7414-200ul 200 ul
EUR 459

RIPK1 Rabbit pAb

A7414-20ul 20 ul
EUR 183

RIPK1 Rabbit pAb

A7414-50ul 50 ul
EUR 223

Polyclonal RIPK1 antibody - middle region

APR01895G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 - middle region. This antibody is tested and proven to work in the following applications:

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Hu-48T 48T
EUR 517
  • Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Hu-96T 96T
EUR 673
  • Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Ra-48T 48T
EUR 549
  • Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Ra-96T 96T
EUR 718
  • Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Hu-48Tests 48 Tests
EUR 544

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Hu-96Tests 96 Tests
EUR 756

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Ra-48Tests 48 Tests
EUR 583

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Ra-96Tests 96 Tests
EUR 811

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Hu-48Tests 48 Tests
EUR 521

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Hu-96Tests 96 Tests
EUR 723

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Ra-48Tests 48 Tests
EUR 557

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Ra-96Tests 96 Tests
EUR 775

RIPK1 Antibody

24965-100ul 100ul
EUR 390

RIPK1 antibody

70R-10453 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK1 antibody

RIPK1 antibody

70R-21675 50 ul
EUR 435
Description: Rabbit polyclonal RIPK1 antibody

RIPK1 Antibody

44878-100ul 100ul
EUR 252

RIPK1 Antibody

44878-50ul 50ul
EUR 187

RIPK1 Antibody

1-CSB-PA618785LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500

Ripk1 Antibody

1-CSB-PA720181LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse, Human. This antibody is Unconjugated. Tested in the following application: ELISA, IP; Recommended dilution: IP:1:200-1:2000

RIPK1 Antibody

DF8234 200ul
EUR 304
Description: RIPK1 Antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody

DF2642 200ul
EUR 304
Description: RIPK1 antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody

AF7588 200ul
EUR 376
Description: RIPK1 Antibody detects endogenous levels of RIPK1.

RIPK1 Antibody

1-CSB-PA019735GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPk1 Antibody

AF7877 200ul
EUR 376
Description: RIP Antibody detects endogenous levels of RIP.

RIPK1 Antibody

ABD2642 100 ug
EUR 438

RIPK1 Antibody

ABD8234 100 ug
EUR 438

Polyclonal RIPK1 / RIP Antibody (N-Terminus)

APR02641G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 / RIP (N-Terminus). This antibody is tested and proven to work in the following applications:

RIPK1 (Phospho-Tyr284) Polyclonal Conjugated Antibody

C12953 100ul
EUR 397

Phospho-RIPK1-S166 Rabbit pAb

AP1115-100ul 100 ul
EUR 384

Phospho-RIPK1-S166 Rabbit pAb

AP1115-200ul 200 ul
EUR 554

Phospho-RIPK1-S166 Rabbit pAb

AP1115-20ul 20 ul
EUR 183

Phospho-RIPK1-S166 Rabbit pAb

AP1115-50ul 50 ul
EUR 265

RIPK1 Conjugated Antibody

C44878 100ul
EUR 397

RIPK1-Specific Antibody

abx237313-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-RIPK1 antibody

STJ29550 100 µl
EUR 277

Anti-RIPK1 antibody

STJ191954 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIPK1

Anti-RIPK1 Antibody

STJ502798 100 µg
EUR 476

RIPK1 siRNA

20-abx931562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK1 siRNA

20-abx931563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK1 (Phospho-Tyr284) Antibody

12953-100ul 100ul
EUR 252

RIPK1 (Phospho-Tyr284) Antibody

12953-50ul 50ul
EUR 187

RIPK1 Antibody, HRP conjugated

1-CSB-PA618785LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK1 Antibody, FITC conjugated

1-CSB-PA618785LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK1 Antibody, Biotin conjugated

1-CSB-PA618785LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ripk1 Antibody, HRP conjugated

1-CSB-PA720181LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ripk1 Antibody, FITC conjugated

1-CSB-PA720181LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ripk1 Antibody, Biotin conjugated

1-CSB-PA720181LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-RIPK1 (Ser166) Antibody

AF2398 200ul
EUR 304
Description: Phospho-RIP (Ser166) Antibody detects endogenous levels of RIP.

Phospho-RIPK1(Tyr384) Antibody

AF7088 200ul
EUR 376
Description: Phospho-RIPK1(Tyr284) Antibody detects endogenous levels of RIPK1 only when phosphorylated at Tyr284.

Phospho-RIPk1 (Ser161) Antibody

AF7377 200ul
EUR 376
Description: Phospho-RIP (Ser161) Antibody detects endogenous levels of RIP only when phosphorylated at Ser161.

anti- RIPK1-Specific antibody

FNab07313 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: receptor(TNFRSF)-interacting serine-threonine kinase 1
  • Uniprot ID: Q13546
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK1-Specific

Anti-RIP/RIPK1 Antibody

PA2051 100ug/vial
EUR 294

Anti-RIPK1-Specific antibody

PAab07313 100 ug
EUR 386

Anti-RIP/RIPK1 Antibody

PB9116 100ug/vial
EUR 294

Anti-RIPK1 Antibody (Biotin)

STJ502799 100 µg
EUR 586

Anti-RIPK1 Antibody (FITC)

STJ502800 100 µg
EUR 586

Rabbit Anti-Human RIPK1 monoclonal antibody, clone KK103-19

CABT-L850 100 ul
EUR 777

RIPK1 Blocking Peptide

33R-8158 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK1 antibody, catalog no. 70R-10453

RIPK1 Blocking Peptide

DF8234-BP 1mg
EUR 195

RIPK1 Blocking Peptide

DF2642-BP 1mg
EUR 195

RIPK1 Blocking Peptide

AF7588-BP 1mg
EUR 195

RIPK1 cloning plasmid

CSB-CL618785HU-10ug 10ug
EUR 674
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2016
  • Sequence: atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggcttcgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgagg
  • Show more
Description: A cloning plasmid for the RIPK1 gene.

RIPk1 Blocking Peptide

AF7877-BP 1mg
EUR 195

RIPK1-IN-7

HY-119933 100mg
EUR 3838

RIPK1-IN-4

HY-18901 25mg
EUR 1187

Anti-Phospho-RIPK1-S166 antibody

STJ11101149 100 µl
EUR 393

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human)

4-PAE640Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1)

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat)

4-PAE640Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1)

RIPK1 ELISA KIT|Human

EF002481 96 Tests
EUR 689

Mouse RIPK1 shRNA Plasmid

20-abx972462
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RIPK1 shRNA Plasmid

20-abx955755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), APC

4-PAE640Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), Biotinylated

4-PAE640Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), Cy3

4-PAE640Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), FITC

4-PAE640Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), HRP

4-PAE640Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), PE

4-PAE640Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with PE.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), APC

4-PAE640Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), Biotinylated

4-PAE640Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), Cy3

4-PAE640Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), FITC

4-PAE640Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), HRP

4-PAE640Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), PE

4-PAE640Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with PE.

Phospho-RIPK1 (Ser166) Blocking Peptide

AF2398-BP 1mg
EUR 195

Phospho-RIPK1(Tyr384) Blocking Peptide

AF7088-BP 1mg
EUR 195

Phospho-RIPk1 (Ser161) Blocking Peptide

AF7377-BP 1mg
EUR 195

Ripk1 ORF Vector (Rat) (pORF)

ORF075392 1.0 ug DNA
EUR 506

h RIPK1 inducible lentiviral particles

LVP786 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1 ), [alternative names: RIP; RIP1]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003804.3. It also contains a RFP-Blasticidin dual selection marker.

RIPK1 ORF Vector (Human) (pORF)

ORF028956 1.0 ug DNA
EUR 95

Ripk1 ORF Vector (Mouse) (pORF)

ORF056094 1.0 ug DNA
EUR 506

RIPK1 ELISA Kit (Human) (OKAN06497)

OKAN06497 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein plays a role in inflammation and cell death in response to tissue damage, pathogen recognition, and as part of developmental regulation. RIPK1/RIPK3 kinase-mediated necrosis is referred to as necroptosis. Genetic disruption of this gene in mice results in death shortly after birth.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

RIPK1 ELISA Kit (Mouse) (OKCA01762)

OKCA01762 96 Wells
EUR 846
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex. Interacts with ARHGEF2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 ng/mL

RIPK1 ELISA Kit (Human) (OKCD00436)

OKCD00436 96 Wells
EUR 831
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

RIPK1 ELISA Kit (Rat) (OKCD00437)

OKCD00437 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

RIPK1 ELISA Kit (Human) (OKDD00507)

OKDD00507 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), APC-Cy7

4-PAE640Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC-Cy7.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), APC-Cy7

4-PAE640Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK1 (Met1~Ala179)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC-Cy7.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx007191
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

abx027672-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

abx027672-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx115084
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx128294
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx131543
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

abx145080-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx146747
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx174346
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx174347
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody

20-abx338927
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody

20-abx300043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal RIPK1 / RIP Antibody (clone 7H10), Clone: 7H10

AMM02144G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human RIPK1 / RIP (clone 7H10). The antibodies are raised in Mouse and are from clone 7H10. This antibody is applicable in WB and IHC-P, IP

Monoclonal RIPK1 / RIP Antibody (clone 2G3), Clone: 2G3

AMM02298G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human RIPK1 / RIP (clone 2G3). The antibodies are raised in Mouse and are from clone 2G3. This antibody is applicable in WB and IHC-P

Ripk1 sgRNA CRISPR Lentivector set (Mouse)

K5037801 3 x 1.0 ug
EUR 339

Ripk1 sgRNA CRISPR Lentivector set (Rat)

K6746301 3 x 1.0 ug
EUR 339

RIPK1 sgRNA CRISPR Lentivector set (Human)

K1825801 3 x 1.0 ug
EUR 339

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (HRP)

20-abx337447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (FITC)

20-abx337448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (Biotin)

20-abx337449
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (HRP)

20-abx300040
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (FITC)

20-abx300041
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (Biotin)

20-abx300042
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CASP2 And RIPK1 Domain Containing Adaptor With Death Domain Protein (CRADD) Polyclonal Antibody (Human)

4-PAL376Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRADD (Met1~Glu199)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CASP2 And RIPK1 Domain Containing Adaptor With Death Domain Protein (CRADD)

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

RIPK1 Rabbit Polyclonal Antibody