RIPK3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

RIPK3 Polyclonal Antibody

ABP60181-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIPK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK3 from Human. This RIPK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK3 protein

RIPK3 Polyclonal Antibody

ABP60181-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK3 from Human. This RIPK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK3 protein

RIPK3 Polyclonal Antibody

A60610 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK3 Rabbit pAb

A12996-100ul 100 ul
EUR 308

RIPK3 Rabbit pAb

A12996-200ul 200 ul
EUR 459

RIPK3 Rabbit pAb

A12996-20ul 20 ul
EUR 183

RIPK3 Rabbit pAb

A12996-50ul 50 ul
EUR 223

Polyclonal RIPK3 Antibody (C-term)

APR03974G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 (C-term). This antibody is tested and proven to work in the following applications:

RIPK3 Polyclonal Antibody, Biotin Conjugated

A60611 100 µg
EUR 570.55
Description: fast delivery possible

RIPK3 Polyclonal Antibody, FITC Conjugated

A60612 100 µg
EUR 570.55
Description: reagents widely cited

RIPK3 Polyclonal Antibody, HRP Conjugated

A60613 100 µg
EUR 570.55
Description: Ask the seller for details

RIPK3 Antibody

AF4808 200ul
EUR 376
Description: RIPK3 Antibody detects endogenous levels of RIPK3.

RIPK3 Antibody

ABD7339 100 ug
EUR 438

RIPK3 Antibody

ABD10141 100 ug
EUR 438

RIPK3 antibody

38654-100ul 100ul
EUR 252

RIPK3 antibody

20R-1514 100 ug
EUR 673
Description: Rabbit polyclonal RIPK3 antibody

RIPK3 antibody

70R-19905 50 ul
EUR 435
Description: Rabbit polyclonal RIPK3 antibody

RIPK3 Antibody

DF7339 200ul
EUR 304
Description: RIPK3 Antibody detects endogenous levels of total RIPK3.

RIPK3 Antibody

1-CSB-PA897497ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK3 Antibody

1-CSB-PA897497LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:200-1:500

RIPK3 Antibody

DF10141 200ul
EUR 304
Description: RIPK3 Antibody detects endogenous levels of total RIPK3.

RIPK3 Antibody

1-CSB-PA019737GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Hu-48T 48T
EUR 517
  • Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Hu-96T 96T
EUR 673
  • Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Ra-48T 48T
EUR 549
  • Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Ra-96T 96T
EUR 718
  • Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Hu-48Tests 48 Tests
EUR 521

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Hu-96Tests 96 Tests
EUR 723

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Ra-48Tests 48 Tests
EUR 557

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Ra-96Tests 96 Tests
EUR 775

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Hu-48Tests 48 Tests
EUR 544

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Hu-96Tests 96 Tests
EUR 756

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Ra-48Tests 48 Tests
EUR 583

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Ra-96Tests 96 Tests
EUR 811

Polyclonal RIPK3 antibody - N-terminal region

APR00553G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RIPK3 / RIP3 Antibody (aa480-530)

APR02432G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 / RIP3 (aa480-530). This antibody is tested and proven to work in the following applications:

RIPK3 Conjugated Antibody

C38654 100ul
EUR 397

Anti-RIPK3 Antibody

STJ502804 100 µg
EUR 476

Anti-RIPK3 Antibody

STJ502805 100 µg
EUR 476

Anti-RIPK3 antibody

STJ27384 100 µl
EUR 277
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.

Anti-RIPK3 antibody

STJ114965 100 µl
EUR 277
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.

Anti-RIPK3 antibody

STJ191986 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIPK3

Ripk3/ Rat Ripk3 ELISA Kit

ELI-45139r 96 Tests
EUR 886

RIPK3 siRNA

20-abx904586
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK3 siRNA

20-abx931566
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK3 siRNA

20-abx931567
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-RIPK3(Ser316) Antibody

AF4508 200ul
EUR 376
Description: Phospho-RIPK3(Ser316) Antibody detects endogenous levels of RIPK3 only when phosphorylated at Ser316.

RIPK3 Antibody, HRP conjugated

1-CSB-PA897497LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK3 Antibody, FITC conjugated

1-CSB-PA897497LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK3 Antibody, Biotin conjugated

1-CSB-PA897497LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP3/RIPK3 Antibody

PA2242 100ug/vial
EUR 294

Anti-RIPK3 Antibody (Biotin)

STJ502806 100 µg
EUR 586

Anti-RIPK3 Antibody (FITC)

STJ502807 100 µg
EUR 586

Anti-RIPK3 Antibody (Biotin)

STJ502808 100 µg
EUR 586

Anti-RIPK3 Antibody (FITC)

STJ502809 100 µg
EUR 586

RIPK3 Blocking Peptide

AF4808-BP 1mg
EUR 195

RIPK3 Blocking Peptide

20-abx161414
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RIPK3 Blocking Peptide

DF7339-BP 1mg
EUR 195

RIPK3 Blocking Peptide

DF10141-BP 1mg
EUR 195

RIPK3 cloning plasmid

CSB-CL897497HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atgtcgtgcgtcaagttatggcccagcggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaaaggcgggttcggcacagtgttccgggcgcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgaaggcgatatccag
  • Show more
Description: A cloning plasmid for the RIPK3 gene.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse)

4-PAE639Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3)

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat)

4-PAE639Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3)

Mouse RIPK3 shRNA Plasmid

20-abx974829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RIPK3 shRNA Plasmid

20-abx987959
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RIPK3 ELISA KIT|Human

EF010939 96 Tests
EUR 689

Human RIPK3 ELISA KIT

ELI-30289h 96 Tests
EUR 824

Mouse Ripk3 ELISA KIT

ELI-30290m 96 Tests
EUR 865

Human RIPK3 shRNA Plasmid

20-abx957541
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-RIPK3 Plasmid

PVTB00720 2 ug
EUR 356

pCMV-HA-RIPK3 Plasmid

PVTB00720-2a 2 ug
EUR 356

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), APC

4-PAE639Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Biotinylated

4-PAE639Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Cy3

4-PAE639Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), FITC

4-PAE639Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), HRP

4-PAE639Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), PE

4-PAE639Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), APC

4-PAE639Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Biotinylated

4-PAE639Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Cy3

4-PAE639Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), FITC

4-PAE639Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), HRP

4-PAE639Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), PE

4-PAE639Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE.

Phospho-RIPK3(Ser316) Blocking Peptide

AF4508-BP 1mg
EUR 195

RIPK3 ORF Vector (Human) (pORF)

ORF008829 1.0 ug DNA
EUR 95

Ripk3 ORF Vector (Mouse) (pORF)

ORF056096 1.0 ug DNA
EUR 506

Ripk3 ORF Vector (Mouse) (pORF)

ORF056097 1.0 ug DNA
EUR 506

Ripk3 ORF Vector (Mouse) (pORF)

ORF056098 1.0 ug DNA
EUR 506

Ripk3 ORF Vector (Rat) (pORF)

ORF075394 1.0 ug DNA
EUR 506

RIPK3 ELISA Kit (Rat) (OKAN06271)

OKAN06271 96 Wells
EUR 792
Description: Description of target: a putative homocysteine respondent protein [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

RIPK3 ELISA Kit (Human) (OKAN06325)

OKAN06325 96 Wells
EUR 792
Description: Description of target: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL

RIPK3 ELISA Kit (Human) (OKCD02850)

OKCD02850 96 Wells
EUR 831
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL

RIPK3 ELISA Kit (Mouse) (OKCD02851)

OKCD02851 96 Wells
EUR 857
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL

RIPK3 ELISA Kit (Human) (OKCA02138)

OKCA02138 96 Wells
EUR 833
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

RIPK3 ELISA Kit (Rat) (OKCD08674)

OKCD08674 96 Wells
EUR 1053
Description: Description of target: a putative homocysteine respondent protein.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

RIPK3 ELISA Kit (Human) (OKEH07133)

OKEH07133 96 Wells
EUR 779
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), APC-Cy7

4-PAE639Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC-Cy7.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), APC-Cy7

4-PAE639Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC-Cy7.

Receptor-Interacting Serine-Threonine Kinase 3 (RIPK3) Antibody

20-abx115091
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx121704
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx000804
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

abx038228-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx104444
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx104445
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx004160
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx174348
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx174349
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx178226
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx320360
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody

20-abx301766
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RIPK3 sgRNA CRISPR Lentivector set (Human)

K1826001 3 x 1.0 ug
EUR 339

Ripk3 sgRNA CRISPR Lentivector set (Mouse)

K3734101 3 x 1.0 ug
EUR 339

Ripk3 sgRNA CRISPR Lentivector set (Rat)

K7299301 3 x 1.0 ug
EUR 339

h RIPK3 (6His) inducible lentiviral particles

LVP856 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h RIPK3 (6His) (receptor-interacting serine-threonine kinase 3), [alternative names: RIP3]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_006871.3. It also contains a RFP-Blasticidin dual selection marker.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (HRP)

20-abx312526
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (FITC)

20-abx312527
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (Biotin)

20-abx312528
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RIPK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1826002 1.0 ug DNA
EUR 154

RIPK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1826003 1.0 ug DNA
EUR 154

RIPK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1826004 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3734102 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3734103 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3734104 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7299302 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7299303 1.0 ug DNA
EUR 154

Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7299304 1.0 ug DNA
EUR 154

RIPK3 Protein Vector (Human) (pPB-C-His)

PV035313 500 ng
EUR 329

RIPK3 Protein Vector (Human) (pPB-N-His)

PV035314 500 ng
EUR 329

RIPK3 Protein Vector (Human) (pPM-C-HA)

PV035315 500 ng
EUR 329

RIPK3 Protein Vector (Human) (pPM-C-His)

PV035316 500 ng
EUR 329

Recombinant Mouse Ripk3 Protein, His, Yeast-100ug

QP9919-ye-100ug 100ug
EUR 571

Recombinant Mouse Ripk3 Protein, His, Yeast-10ug

QP9919-ye-10ug 10ug
EUR 272

Recombinant Mouse Ripk3 Protein, His, Yeast-1mg

QP9919-ye-1mg 1mg
EUR 2303

Recombinant Mouse Ripk3 Protein, His, Yeast-200ug

QP9919-ye-200ug 200ug
EUR 898

Recombinant Mouse Ripk3 Protein, His, Yeast-500ug

QP9919-ye-500ug 500ug
EUR 1505

Recombinant Mouse Ripk3 Protein, His, Yeast-50ug

QP9919-ye-50ug 50ug
EUR 354

Recombinant Human Ripk3 Protein, His, Baculovirus-100ug

QP9945-ba-100ug 100ug
EUR 1260

Recombinant Human Ripk3 Protein, His, Baculovirus-20ug

QP9945-ba-20ug 20ug
EUR 489

Recombinant Human Ripk3 Protein, His, Baculovirus-50ug

QP9945-ba-50ug 50ug
EUR 915

Recombinant Human Ripk3 Protein, His, Yeast-100ug

QP9945-ye-100ug 100ug
EUR 480

Recombinant Human Ripk3 Protein, His, Yeast-10ug

QP9945-ye-10ug 10ug
EUR 236

Recombinant Human Ripk3 Protein, His, Yeast-1mg

QP9945-ye-1mg 1mg
EUR 1885

Recombinant Human Ripk3 Protein, His, Yeast-200ug

QP9945-ye-200ug 200ug
EUR 744

Recombinant Human Ripk3 Protein, His, Yeast-500ug

QP9945-ye-500ug 500ug
EUR 1206

Recombinant Human Ripk3 Protein, His, Yeast-50ug

QP9945-ye-50ug 50ug
EUR 299

RIPK3 Protein Vector (Rat) (pPB-C-His)

PV301574 500 ng
EUR 603

RIPK3 Protein Vector (Rat) (pPB-N-His)

PV301575 500 ng
EUR 603

RIPK3 Protein Vector (Rat) (pPM-C-HA)

PV301576 500 ng
EUR 603

RIPK3 Protein Vector (Rat) (pPM-C-His)

PV301577 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-C-His)

PV224382 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-N-His)

PV224383 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-HA)

PV224384 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-His)

PV224385 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-C-His)

PV224386 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-N-His)

PV224387 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-HA)

PV224388 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-His)

PV224389 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-C-His)

PV224390 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPB-N-His)

PV224391 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-HA)

PV224392 500 ng
EUR 603

RIPK3 Protein Vector (Mouse) (pPM-C-His)

PV224393 500 ng
EUR 603

Ripk3 3'UTR GFP Stable Cell Line

TU167905 1.0 ml Ask for price

RIPK3 3'UTR Luciferase Stable Cell Line

TU019938 1.0 ml
EUR 1394

Ripk3 3'UTR Luciferase Stable Cell Line

TU117905 1.0 ml Ask for price

RIPK3 3'UTR GFP Stable Cell Line

TU069938 1.0 ml
EUR 1394

Ripk3 3'UTR Luciferase Stable Cell Line

TU219458 1.0 ml Ask for price

Ripk3 3'UTR GFP Stable Cell Line

TU269458 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RIPK3 Rabbit Polyclonal Antibody