STRN3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

STRN3 Polyclonal Antibody

ABP60547-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein

STRN3 Polyclonal Antibody

ABP60547-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein

STRN3 Polyclonal Antibody

ABP60547-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein

STRN3 Rabbit pAb

A12586-100ul 100 ul
EUR 308

STRN3 Rabbit pAb

A12586-200ul 200 ul
EUR 459

STRN3 Rabbit pAb

A12586-20ul 20 ul
EUR 183

STRN3 Rabbit pAb

A12586-50ul 50 ul
EUR 223

STRN3 Rabbit pAb

A6756-100ul 100 ul
EUR 308

STRN3 Rabbit pAb

A6756-200ul 200 ul
EUR 459

STRN3 Rabbit pAb

A6756-20ul 20 ul
EUR 183

STRN3 Rabbit pAb

A6756-50ul 50 ul
EUR 223

STRN3 antibody

39154-100ul 100ul
EUR 252

Strn3/ Rat Strn3 ELISA Kit

ELI-52168r 96 Tests
EUR 886

STRN3 Conjugated Antibody

C39154 100ul
EUR 397

Anti-STRN3 antibody

STJ28839 100 µl
EUR 277

Anti-STRN3 antibody

STJ114460 100 µl
EUR 277

Anti-STRN3 antibody

STJ191908 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STRN3

STRN3 siRNA

20-abx905346
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STRN3 siRNA

20-abx935544
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STRN3 siRNA

20-abx935545
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Striatin-3 (STRN3) Antibody

20-abx005180
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

STRN3 cloning plasmid

CSB-CL614388HU1-10ug 10ug
EUR 709
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2142
  • Sequence: atggacgagcttgccggaggcggtggtggcggcccggggatggcggcccctccccggcagcagcagggacctggggggaacctgggcctttcgcccggggggaacggagcggcgggcggcgggggtcctccggcctccgagggagcgggtcccgcggcaggccccgagctgtccc
  • Show more
Description: A cloning plasmid for the STRN3 gene.

STRN3 cloning plasmid

CSB-CL614388HU2-10ug 10ug
EUR 709
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2142
  • Sequence: atggacgagcttgccggaggcggtggtggcggcccggggatggcggcccctccccggcagcagcagggacctggggggaacctgggcctttcgcccggggggaacggagcggcgggcggcgggggtcctccggcctccgagggagcgggtcccgcggcaggccccgagctgtccc
  • Show more
Description: A cloning plasmid for the STRN3 gene.

Mouse STRN3 shRNA Plasmid

20-abx979284
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STRN3 shRNA Plasmid

20-abx987202
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STRN3 shRNA Plasmid

20-abx959304
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STRN3 Recombinant Protein (Human)

RP043831 100 ug Ask for price

STRN3 Recombinant Protein (Human)

RP043834 100 ug Ask for price

STRN3 Recombinant Protein (Rat)

RP231551 100 ug Ask for price

STRN3 Recombinant Protein (Mouse)

RP176195 100 ug Ask for price

STRN3 Recombinant Protein (Mouse)

RP176198 100 ug Ask for price

Strn3 ORF Vector (Mouse) (pORF)

ORF058733 1.0 ug DNA
EUR 506

Strn3 ORF Vector (Mouse) (pORF)

ORF058734 1.0 ug DNA
EUR 506

Strn3 ORF Vector (Rat) (pORF)

ORF077185 1.0 ug DNA
EUR 506

STRN3 ORF Vector (Human) (pORF)

ORF014611 1.0 ug DNA
EUR 354

STRN3 ORF Vector (Human) (pORF)

ORF014612 1.0 ug DNA
EUR 354

Human Striatin- 3, STRN3 ELISA KIT

ELI-52621h 96 Tests
EUR 824

Mouse Striatin- 3, Strn3 ELISA KIT

ELI-52622m 96 Tests
EUR 865

Bovine Striatin- 3, STRN3 ELISA KIT

ELI-53368b 96 Tests
EUR 928

STRN3 sgRNA CRISPR Lentivector set (Human)

K2307401 3 x 1.0 ug
EUR 339

Strn3 sgRNA CRISPR Lentivector set (Mouse)

K4874301 3 x 1.0 ug
EUR 339

Strn3 sgRNA CRISPR Lentivector set (Rat)

K7109501 3 x 1.0 ug
EUR 339

Human Striatin 3(STRN3)ELISA Kit

QY-E01033 96T
EUR 361

STRN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2307402 1.0 ug DNA
EUR 154

STRN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2307403 1.0 ug DNA
EUR 154

STRN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2307404 1.0 ug DNA
EUR 154

Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4874302 1.0 ug DNA
EUR 154

Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4874303 1.0 ug DNA
EUR 154

Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4874304 1.0 ug DNA
EUR 154

ELISA kit for Rat Striatin-3 (STRN3)

KTE100141-48T 48T
EUR 332
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Striatin-3 (STRN3)

KTE100141-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Striatin-3 (STRN3)

KTE100141-96T 96T
EUR 539
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Striatin-3 (STRN3)

KTE10079-48T 48T
EUR 354
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Striatin-3 (STRN3)

KTE10079-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Striatin-3 (STRN3)

KTE10079-96T 96T
EUR 572
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Strn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7109502 1.0 ug DNA
EUR 154

Strn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7109503 1.0 ug DNA
EUR 154

Strn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7109504 1.0 ug DNA
EUR 154

ELISA kit for Mouse Striatin-3 (STRN3)

KTE70273-48T 48T
EUR 332
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Striatin-3 (STRN3)

KTE70273-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Striatin-3 (STRN3)

KTE70273-96T 96T
EUR 539
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Striatin-3 (STRN3)

KTE60394-48T 48T
EUR 332
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Striatin-3 (STRN3)

KTE60394-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Striatin-3 (STRN3)

KTE60394-96T 96T
EUR 539
  • Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

STRN3 Protein Vector (Human) (pPB-C-His)

PV058441 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPB-N-His)

PV058442 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPM-C-HA)

PV058443 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPM-C-His)

PV058444 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPB-C-His)

PV058445 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPB-N-His)

PV058446 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPM-C-HA)

PV058447 500 ng
EUR 481

STRN3 Protein Vector (Human) (pPM-C-His)

PV058448 500 ng
EUR 481

STRN3 Protein Vector (Rat) (pPB-C-His)

PV308738 500 ng
EUR 1191

STRN3 Protein Vector (Rat) (pPB-N-His)

PV308739 500 ng
EUR 1191

STRN3 Protein Vector (Rat) (pPM-C-HA)

PV308740 500 ng
EUR 1191

STRN3 Protein Vector (Rat) (pPM-C-His)

PV308741 500 ng
EUR 1191

STRN3 Protein Vector (Mouse) (pPB-C-His)

PV234930 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPB-N-His)

PV234931 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPM-C-HA)

PV234932 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPM-C-His)

PV234933 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPB-C-His)

PV234934 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPB-N-His)

PV234935 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPM-C-HA)

PV234936 500 ng
EUR 1065

STRN3 Protein Vector (Mouse) (pPM-C-His)

PV234937 500 ng
EUR 1065

Strn3 3'UTR GFP Stable Cell Line

TU169882 1.0 ml Ask for price

Strn3 3'UTR Luciferase Stable Cell Line

TU119882 1.0 ml Ask for price

STRN3 3'UTR GFP Stable Cell Line

TU074857 1.0 ml
EUR 1521

STRN3 3'UTR Luciferase Stable Cell Line

TU024857 1.0 ml
EUR 1521

Strn3 3'UTR Luciferase Stable Cell Line

TU221347 1.0 ml Ask for price

Strn3 3'UTR GFP Stable Cell Line

TU271347 1.0 ml Ask for price

STRN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665449 1.0 ug DNA
EUR 1355

STRN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665453 1.0 ug DNA
EUR 1355

STRN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665454 1.0 ug DNA
EUR 1355

STRN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702321 1.0 ug DNA
EUR 450

STRN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702325 1.0 ug DNA
EUR 450

STRN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702326 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

STRN3 Rabbit Polyclonal Antibody