TRIB3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

TRIB3 Polyclonal Antibody
ABP60758-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein

TRIB3 Rabbit pAb
A5424-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb
A5424-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb
A5424-20ul 20 ul
EUR 183

TRIB3 Rabbit pAb
A5424-50ul 50 ul
EUR 223

TRIB3 Rabbit pAb
A2346-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb
A2346-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb
A2346-20ul 20 ul Ask for price

TRIB3 Rabbit pAb
A2346-50ul 50 ul Ask for price

TRIB3 antibody
70R-51057 100 ul
EUR 244
Description: Purified Polyclonal TRIB3 antibody

TRIB3 antibody
70R-3572 50 ug
EUR 467
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 antibody
70R-20973 50 ul
EUR 435
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 Antibody
ABD7844 100 ug
EUR 438

TRIB3 Antibody
40167-100ul 100ul
EUR 252

TRIB3 Antibody
DF7844 200ul
EUR 304
Description: TRIB3 Antibody detects endogenous levels of total TRIB3.

TRIB3 Antibody
1-CSB-PA847220LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRIB3 Antibody
1-CSB-PA592034
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIB3 Antibody
1-CSB-PA120599
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRIB3 Antibody
1-CSB-PA024446GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal TRB3 / TRIB3 Antibody (Internal)
APR03193G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal TRIB3 Antibody (C-term)
APR06077G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIB3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (N-Terminus)
APR02010G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (C-Terminus)
APR02015G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (C-Terminus). This antibody is tested and proven to work in the following applications:

TRIB3 Conjugated Antibody
C40167 100ul
EUR 397

anti- TRIB3 antibody
FNab08966 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: tribbles homolog 3(Drosophila)
  • Uniprot ID: Q96RU7
  • Gene ID: 57761
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TRIB3

Anti-TRIB3 antibody
PAab08966 100 ug
EUR 386

Anti-TRIB3 antibody
STJ25963 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody
STJ27377 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody
STJ191991 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRIB3

Trib3/ Rat Trib3 ELISA Kit
ELI-51153r 96 Tests
EUR 886

TRIB3 siRNA
20-abx905776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA
20-abx938004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA
20-abx938005
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRIB3
YF-PA20284 50 ug
EUR 363
Description: Mouse polyclonal to TRIB3

anti-TRIB3
YF-PA20285 100 ug
EUR 403
Description: Rabbit polyclonal to TRIB3

TRIB3 Antibody, HRP conjugated
1-CSB-PA847220LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIB3 Antibody, FITC conjugated
1-CSB-PA847220LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIB3 Antibody, Biotin conjugated
1-CSB-PA847220LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TRIB3 Monoclonal Antibody
M01414 100ug
EUR 397
Description: Rabbit Monoclonal TRIB3 Antibody. Validated in IP, WB and tested in Human.

TRIB3 Blocking Peptide
20-abx063932
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRIB3 Blocking Peptide
33R-10278 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB3 antibody, catalog no. 70R-3572

TRIB3 Blocking Peptide
DF7844-BP 1mg
EUR 195

TRIB3 cloning plasmid
CSB-CL847220HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtg
  • Show more
Description: A cloning plasmid for the TRIB3 gene.

Anti-TRIB3 (1H2)
YF-MA19104 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2G5)
YF-MA19105 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (3D7)
YF-MA19106 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2D1)
YF-MA19107 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2F7)
YF-MA11617 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Monoclonal TRIB3 Antibody, Clone: EPR3150
APR13800G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TRIB3. The antibodies are raised in Rabbit and are from clone EPR3150. This antibody is applicable in WB

Tribbles Homolog 3 (TRIB3) Antibody
20-abx001903
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
abx145410-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
abx033920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
abx033920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
20-abx006614
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
20-abx008081
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
abx238966-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tribbles Homolog 3 (TRIB3) Antibody
20-abx301787
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
20-abx210281
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody
20-abx210462
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (HRP)
20-abx314602
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (FITC)
20-abx314603
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (Biotin)
20-abx314604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat TRIB3 shRNA Plasmid
20-abx987973
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIB3 ELISA Kit
ELA-E9844h 96 Tests
EUR 824

TRIB3 ELISA KIT|Human
EF006551 96 Tests
EUR 689

TRIB3 protein (His tag)
80R-4057 50 ug
EUR 327
Description: Recombinant Human TRIB3 protein (His tag)

Mouse TRIB3 shRNA Plasmid
20-abx981648
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIB3 shRNA Plasmid
20-abx961670
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIB3 Recombinant Protein (Human)
RP032860 100 ug Ask for price

TRIB3 Recombinant Protein (Rat)
RP234629 100 ug Ask for price

TRIB3 Recombinant Protein (Mouse)
RP181031 100 ug Ask for price

pCMV-SPORT6-TRIB3 Plasmid
PVT16467 2 ug
EUR 325

Monoclonal TRIB3 Antibody (monoclonal) (M03), Clone: 1H2
AMM04244G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB and IF

Monoclonal TRIB3 Antibody (monoclonal) (M06), Clone: 2G5
AMM04245G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF, E

h TRIB3 inducible lentiviral particles
LVP128 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB3, is fully sequence verified and matched to NCBI accession ID: NM_021158

Trib3 ORF Vector (Rat) (pORF)
ORF078211 1.0 ug DNA
EUR 506

TRIB3 ORF Vector (Human) (pORF)
ORF010954 1.0 ug DNA
EUR 95

Trib3 ORF Vector (Mouse) (pORF)
ORF060345 1.0 ug DNA
EUR 506

TRIB3 ELISA Kit (Rat) (OKCA02608)
OKCA02608 96 Wells
EUR 846
Description: Description of target: Disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. May bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. Binds to ATF4 and inhibits its transcriptional activation activity. Interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. Interacts with MAPK kinases and regulates activation of MAP kinases. May play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. Does not display kinase activity. Inhibits the transcriptional activity of DDIT3/CHOP and is involved in DDIT3/CHOP-dependent cell death during ER stress. Can inhibit APOBEC3A editing of nuclear DNA.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 10.1 pg/mL

TRIB3 sgRNA CRISPR Lentivector set (Human)
K2462801 3 x 1.0 ug
EUR 339

Trib3 sgRNA CRISPR Lentivector set (Mouse)
K4286101 3 x 1.0 ug
EUR 339

Trib3 sgRNA CRISPR Lentivector set (Rat)
K7247001 3 x 1.0 ug
EUR 339

Cow Tribbles Homolog 3 (TRIB3) ELISA Kit
abx521350-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tribbles Homolog 3 (TRIB3) ELISA Kit
abx521352-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tribbles Homolog 3 (TRIB3) ELISA Kit
abx521353-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TRIB3/ Tribbles homolog 3 ELISA Kit
E2588Hu 1 Kit
EUR 605

Human TRIB3(Tribbles homolog 3) ELISA Kit
EH2519 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96RU7
  • Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Tribbles homolog 3, Trib3 ELISA KIT
ELI-23158m 96 Tests
EUR 865

Human Tribbles homolog 3, TRIB3 ELISA KIT
ELI-36572h 96 Tests
EUR 824

Bovine Tribbles homolog 3, TRIB3 ELISA KIT
ELI-45762b 96 Tests
EUR 928

Human Tribbles homolog 3 (TRIB3) ELISA Kit
abx251890-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2462802 1.0 ug DNA
EUR 154

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2462803 1.0 ug DNA
EUR 154

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2462804 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4286102 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4286103 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4286104 1.0 ug DNA
EUR 154

Human Tribbles homolog 3(TRIB3) ELISA kit
CSB-EL024446HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3 (TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tribbles homolog 3(TRIB3) ELISA kit
1-CSB-EL024446HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3(TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7247002 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7247003 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7247004 1.0 ug DNA
EUR 154

TRIB3 Protein Vector (Human) (pPB-C-His)
PV043813 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPB-N-His)
PV043814 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPM-C-HA)
PV043815 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPM-C-His)
PV043816 500 ng
EUR 329

Recombinant Human TRIB3 Protein, His, E.coli-10ug
QP13815-10ug 10ug
EUR 201

Recombinant Human TRIB3 Protein, His, E.coli-1mg
QP13815-1mg 1mg
EUR 5251

Recombinant Human TRIB3 Protein, His, E.coli-2ug
QP13815-2ug 2ug
EUR 155

TRIB3 Tribbles Pseudokinase 3 Human Recombinant Protein
PROTQ96RU7 Regular: 10ug
EUR 317
Description: TRIB3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 381 amino acids (1-358 a.a) and having a molecular mass of 42.0kDa. TRIB3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

TRIB3 Protein Vector (Rat) (pPB-C-His)
PV312842 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPB-N-His)
PV312843 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPM-C-HA)
PV312844 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPM-C-His)
PV312845 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPB-C-His)
PV241378 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPB-N-His)
PV241379 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPM-C-HA)
PV241380 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPM-C-His)
PV241381 500 ng
EUR 603

Trib3 3'UTR GFP Stable Cell Line
TU171070 1.0 ml Ask for price

TRIB3 3'UTR GFP Stable Cell Line
TU076511 1.0 ml
EUR 1394

Trib3 3'UTR Luciferase Stable Cell Line
TU121070 1.0 ml Ask for price

TRIB3 3'UTR Luciferase Stable Cell Line
TU026511 1.0 ml
EUR 1394

Trib3 3'UTR Luciferase Stable Cell Line
TU222419 1.0 ml Ask for price

Trib3 3'UTR GFP Stable Cell Line
TU272419 1.0 ml Ask for price

TRIB3 ELISA Kit (Human) : 96 Wells (OKEH02021)
OKEH02021 96 Wells
EUR 727
Description: Description of target: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

TRIB3 Rabbit Polyclonal Antibody