TSSC4 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

TSSC4 Polyclonal Antibody
ABP60786-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TSSC4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSSC4 from Human, Mouse, Rat. This TSSC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSSC4 protein
TSSC4 Polyclonal Antibody
ABP60786-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TSSC4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSSC4 from Human, Mouse, Rat. This TSSC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSSC4 protein
TSSC4 Polyclonal Antibody
ES10673-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TSSC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TSSC4 Polyclonal Antibody
ES10673-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TSSC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TSSC4 Antibody
44796-100ul 100ul
EUR 252
TSSC4 Antibody
44796-50ul 50ul
EUR 187
TSSC4 Antibody
DF2487 200ul
EUR 304
Description: TSSC4 antibody detects endogenous levels of total TSSC4.
TSSC4 Antibody
ABD2487 100 ug
EUR 438
Tssc4/ Rat Tssc4 ELISA Kit
ELI-28317r 96 Tests
EUR 886
Human TSSC4 Antibody
32792-05111 150 ug
EUR 261
TSSC4 Conjugated Antibody
C44796 100ul
EUR 397
anti- TSSC4 antibody
FNab09072 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:10-1:100
  • Immunogen: tumor suppressing subtransferable candidate 4
  • Uniprot ID: Q9Y5U2
  • Gene ID: 10078
  • Research Area: Cancer
Description: Antibody raised against TSSC4
Anti-TSSC4 antibody
PAab09072 100 ug
EUR 412
Anti-TSSC4 antibody
STJ191831 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSSC4
Human Protein TSSC4, TSSC4 ELISA KIT
ELI-51225h 96 Tests
EUR 824
Bovine Protein TSSC4, TSSC4 ELISA KIT
ELI-45743b 96 Tests
EUR 928
Mouse Protein TSSC4, Tssc4 ELISA KIT
ELI-40054m 96 Tests
EUR 865
TSSC4 siRNA
20-abx905843
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSSC4 siRNA
20-abx938386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSSC4 siRNA
20-abx938387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSSC4 cloning plasmid
CSB-CL897299HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 798
  • Sequence: atggctgaggcaggaacaggcctcctcccagccacggtgcagccattccatctgagaggcatgagctccaccttctcccagcgcagccgtgacatctttgactgcctggagggggcggccagacgggctccatcctctgtggcccacaccagcatgagtgacaacggaggcttcaa
  • Show more
Description: A cloning plasmid for the TSSC4 gene.
TSSC4 cloning plasmid
CSB-CL897299HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaacacgggacggagtatgacacgctgccttccgacacagtctccctcagtgactcggactctgacctcagcttgcccggtggtgctgaagtggaagcactgtccccgatggggctgcctggggaggagga
  • Show more
Description: A cloning plasmid for the TSSC4 gene.
TSSC4 Blocking Peptide
DF2487-BP 1mg
EUR 195
Human TSSC4 Antibody (Biotin Conjugate)
32792-05121 150 ug
EUR 369
TSSC4 protein (His tag)
80R-2112 100 ug
EUR 424
Description: Recombinant human TSSC4 protein (His tag)
TSSC4 ELISA KIT|Human
EF003913 96 Tests
EUR 689
Rat TSSC4 shRNA Plasmid
20-abx990244
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TSSC4 shRNA Plasmid
20-abx974923
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TSSC4 shRNA Plasmid
20-abx956789
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TSSC4 Recombinant Protein (Rat)
RP235064 100 ug Ask for price
TSSC4 Recombinant Protein (Human)
RP033238 100 ug Ask for price
TSSC4 Recombinant Protein (Human)
RP033241 100 ug Ask for price
TSSC4 Recombinant Protein (Mouse)
RP181871 100 ug Ask for price
TSSC4 Recombinant Protein (Mouse)
RP181874 100 ug Ask for price
TSSC4 Recombinant Protein (Mouse)
RP181877 100 ug Ask for price
Human TSSC4 AssayLite Antibody (FITC Conjugate)
32792-05141 150 ug
EUR 428
Human TSSC4 AssayLite Antibody (RPE Conjugate)
32792-05151 150 ug
EUR 428
Human TSSC4 AssayLite Antibody (APC Conjugate)
32792-05161 150 ug
EUR 428
Human TSSC4 AssayLite Antibody (PerCP Conjugate)
32792-05171 150 ug
EUR 471
Tumor Suppressing Subtransferable Candidate 4 (TSSC4) Antibody
20-abx219508
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tumor Suppressing Subtransferable Candidate 4 (TSSC4) Antibody
abx239072-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tssc4 ORF Vector (Rat) (pORF)
ORF078356 1.0 ug DNA
EUR 506
TSSC4 ORF Vector (Human) (pORF)
ORF011080 1.0 ug DNA
EUR 95

TSSC4 Rabbit Polyclonal Antibody