UBAP1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBAP1 Polyclonal Antibody
ABP60818-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBAP1 from Human, Mouse, Rat. This UBAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBAP1 protein

UBAP1 Polyclonal Antibody
ABP60818-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBAP1 from Human, Mouse, Rat. This UBAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBAP1 protein

UBAP1 Polyclonal Antibody
A67530 100 µg
EUR 570.55
Description: kits suitable for this type of research

UBAP1 Rabbit pAb
A4726-100ul 100 ul
EUR 308

UBAP1 Rabbit pAb
A4726-200ul 200 ul
EUR 459

UBAP1 Rabbit pAb
A4726-20ul 20 ul Ask for price

UBAP1 Rabbit pAb
A4726-50ul 50 ul Ask for price

UBAP1 antibody
70R-21091 50 ul
EUR 435
Description: Rabbit polyclonal UBAP1 antibody

UBAP1 Antibody
40173-100ul 100ul
EUR 252

UBAP1 Antibody
1-CSB-PA955770
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UBAP1 Antibody
1-CSB-PA959689
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

UBAP1 Antibody
1-CSB-PA873701LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UBAP1 Antibody
DF12064 200ul
EUR 304
Description: UBAP1 antibody detects endogenous levels of UBAP1.

UBAP1 Antibody
1-CSB-PA025424GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal UBAP1 Antibody (N-term)
APR06125G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBAP1 (N-term). This antibody is tested and proven to work in the following applications:

UBAP1 Polyclonal Antibody, HRP Conjugated
A67531 100 µg
EUR 570.55
Description: fast delivery possible

UBAP1 Polyclonal Antibody, FITC Conjugated
A67532 100 µg
EUR 570.55
Description: reagents widely cited

UBAP1 Polyclonal Antibody, Biotin Conjugated
A67533 100 µg
EUR 570.55
Description: Ask the seller for details

UBAP1 Conjugated Antibody
C40173 100ul
EUR 397

anti- UBAP1 antibody
FNab09149 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100；IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin associated protein 1
  • Uniprot ID: Q9NZ09
  • Gene ID: 51271
  • Research Area: Metabolism
Description: Antibody raised against UBAP1

Anti-UBAP1 antibody
PAab09149 100 ug
EUR 386

Anti-UBAP1 antibody
STJ26827 100 µl
EUR 277
Description: This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-UBAP1 antibody
STJ191588 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBAP1

Ubap1/ Rat Ubap1 ELISA Kit
ELI-28399r 96 Tests
EUR 886

UBAP1 siRNA
20-abx905900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBAP1 siRNA
20-abx938737
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBAP1 siRNA
20-abx938738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-UBAP1
YF-PA18954 50 ug
EUR 363
Description: Mouse polyclonal to UBAP1

UBAP1 Antibody, HRP conjugated
1-CSB-PA873701LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBAP1 Antibody, FITC conjugated
1-CSB-PA873701LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBAP1 Antibody, Biotin conjugated
1-CSB-PA873701LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ubiquitin Associated Protein 1 (UBAP1) Polyclonal Antibody (Human)
4-PAC583Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBAP1 (Met1~Asn295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Associated Protein 1 (UBAP1)

Ubiquitin Associated Protein 1 (UBAP1) Polyclonal Antibody (Mouse)
4-PAC583Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBAP1 (Met1~Asp224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ubiquitin Associated Protein 1 (UBAP1)

UBAP1 cloning plasmid
CSB-CL873701HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1509
  • Sequence: ATGGCTTCTAAGAAGTTGGGTGCAGATTTTCATGGGACTTTCAGTTACCTTGATGATGTCCCATTTAAGACAGGAGACAAATTCAAAACACCAGCTAAAGTTGGTCTACCTATTGGCTTCTCCTTGCCTGATTGTTTGCAGGTTGTCAGAGAAGTACAGTATGACTTCTCTTTGG
  • Show more
Description: A cloning plasmid for the UBAP1 gene.

UBAP1 Rabbit Polyclonal Antibody