UBAP1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
UBAP1 Polyclonal Antibody |
ABP60818-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UBAP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBAP1 from Human, Mouse, Rat. This UBAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBAP1 protein |
UBAP1 Polyclonal Antibody |
ABP60818-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBAP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBAP1 from Human, Mouse, Rat. This UBAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBAP1 protein |
UBAP1 Polyclonal Antibody |
A67530 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
UBAP1 Rabbit pAb |
A4726-100ul |
Abclonal |
100 ul |
EUR 308 |
UBAP1 Rabbit pAb |
A4726-200ul |
Abclonal |
200 ul |
EUR 459 |
UBAP1 Rabbit pAb |
A4726-20ul |
Abclonal |
20 ul |
Ask for price |
UBAP1 Rabbit pAb |
A4726-50ul |
Abclonal |
50 ul |
Ask for price |
UBAP1 antibody |
70R-21091 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBAP1 antibody |
UBAP1 Antibody |
40173-100ul |
SAB |
100ul |
EUR 252 |
UBAP1 Antibody |
1-CSB-PA955770 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
UBAP1 Antibody |
1-CSB-PA959689 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
UBAP1 Antibody |
1-CSB-PA873701LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
UBAP1 Antibody |
DF12064 |
Affbiotech |
200ul |
EUR 304 |
Description: UBAP1 antibody detects endogenous levels of UBAP1. |
UBAP1 Antibody |
1-CSB-PA025424GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal UBAP1 Antibody (N-term) |
APR06125G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBAP1 (N-term). This antibody is tested and proven to work in the following applications: |
UBAP1 Polyclonal Antibody, HRP Conjugated |
A67531 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
UBAP1 Polyclonal Antibody, FITC Conjugated |
A67532 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
UBAP1 Polyclonal Antibody, Biotin Conjugated |
A67533 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
UBAP1 Conjugated Antibody |
C40173 |
SAB |
100ul |
EUR 397 |
anti- UBAP1 antibody |
FNab09149 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IF: 1:10-1:100;IP: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: ubiquitin associated protein 1
- Uniprot ID: Q9NZ09
- Gene ID: 51271
- Research Area: Metabolism
|
Description: Antibody raised against UBAP1 |
Anti-UBAP1 antibody |
STJ26827 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-UBAP1 antibody |
STJ191588 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBAP1 |
UBAP1 siRNA |
20-abx905900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBAP1 siRNA |
20-abx938737 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBAP1 siRNA |
20-abx938738 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UBAP1 |
YF-PA18954 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to UBAP1 |
UBAP1 Antibody, HRP conjugated |
1-CSB-PA873701LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBAP1 Antibody, FITC conjugated |
1-CSB-PA873701LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBAP1 Antibody, Biotin conjugated |
1-CSB-PA873701LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBAP1. Recognizes UBAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Ubiquitin Associated Protein 1 (UBAP1) Polyclonal Antibody (Human) |
4-PAC583Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBAP1 (Met1~Asn295)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Associated Protein 1 (UBAP1) |
Ubiquitin Associated Protein 1 (UBAP1) Polyclonal Antibody (Mouse) |
4-PAC583Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UBAP1 (Met1~Asp224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ubiquitin Associated Protein 1 (UBAP1) |
UBAP1 cloning plasmid |
CSB-CL873701HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1509
- Sequence: ATGGCTTCTAAGAAGTTGGGTGCAGATTTTCATGGGACTTTCAGTTACCTTGATGATGTCCCATTTAAGACAGGAGACAAATTCAAAACACCAGCTAAAGTTGGTCTACCTATTGGCTTCTCCTTGCCTGATTGTTTGCAGGTTGTCAGAGAAGTACAGTATGACTTCTCTTTGG
- Show more
|
Description: A cloning plasmid for the UBAP1 gene. |
UBAP1 Rabbit Polyclonal Antibody