UBE2H Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBE2H Polyclonal Antibody

ABP60820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein

UBE2H Polyclonal Antibody

30894-100ul 100ul
EUR 252

UBE2H Polyclonal Antibody

30894-50ul 50ul
EUR 187

UBE2H Rabbit pAb

A7344-100ul 100 ul
EUR 308

UBE2H Rabbit pAb

A7344-200ul 200 ul
EUR 459

UBE2H Rabbit pAb

A7344-20ul 20 ul
EUR 183

UBE2H Rabbit pAb

A7344-50ul 50 ul
EUR 223

UBE2H Polyclonal Conjugated Antibody

C30894 100ul
EUR 397

UBE2H antibody

70R-21106 50 ul
EUR 435
Description: Rabbit polyclonal UBE2H antibody

UBE2H Antibody

1-CSB-PA025455GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2H. Recognizes UBE2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Ube2h Antibody - N-terminal region

APR00871G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ube2h - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- UBE2H antibody

FNab09176 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2H
  • Uniprot ID: P62256
  • Gene ID: 7328
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2H

Human Ube2H Antibody

33310-05111 150 ug
EUR 261

Anti-UBE2H antibody

PAab09176 100 ug
EUR 386

Anti-UBE2H antibody

STJ29483 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms.

Anti-UBE2H antibody

STJ191596 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2H

UBE2H siRNA

20-abx938780
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2H siRNA

20-abx938781
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2H cloning plasmid

CSB-CL025455HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 552
  • Sequence: atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctga
  • Show more
Description: A cloning plasmid for the UBE2H gene.

Human Ube2H Antibody (Biotin Conjugate)

33310-05121 150 ug
EUR 369

UBE2H ELISA KIT|Human

EF004004 96 Tests
EUR 689

Human UBE2H shRNA Plasmid

20-abx955011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBE2H protein (His tag)

80R-2249 100 ug
EUR 322
Description: Purified recombinant Human UBE2H Protein (His tag)

Mouse UBE2H shRNA Plasmid

20-abx973292
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-UBE2H (3C4-1A2)

LF-MA10365 100 ug
EUR 363
Description: Mouse monoclonal to UBE2H

UBE2H Recombinant Protein (Human)

RP033706 100 ug Ask for price

UBE2H Recombinant Protein (Rat)

RP235556 100 ug Ask for price

UBE2H Recombinant Protein (Mouse)

RP182654 100 ug Ask for price

UBE2H Recombinant Protein (Mouse)

RP182657 100 ug Ask for price

UBE2H Recombinant Protein (Mouse)

RP182660 100 ug Ask for price

Human Ube2H AssayLite Antibody (FITC Conjugate)

33310-05141 150 ug
EUR 428

Human Ube2H AssayLite Antibody (RPE Conjugate)

33310-05151 150 ug
EUR 428

Human Ube2H AssayLite Antibody (APC Conjugate)

33310-05161 150 ug
EUR 428

Human Ube2H AssayLite Antibody (PerCP Conjugate)

33310-05171 150 ug
EUR 471

Ubiquitin-Conjugating Enzyme E2 H (ube2h) Antibody

20-abx116469
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody

20-abx142292
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody

20-abx006923
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody

abx029157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody

abx029157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody

abx239176-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ube2h ORF Vector (Rat) (pORF)

ORF078520 1.0 ug DNA
EUR 506

UBE2H ORF Vector (Human) (pORF)

ORF011236 1.0 ug DNA
EUR 95

UBE2H Rabbit Polyclonal Antibody