UBE2S Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBE2S Polyclonal Antibody

ABP60823-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2S protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2S from Human, Mouse, Rat. This UBE2S antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2S protein

UBE2S Polyclonal Antibody

ABP60823-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2S protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2S from Human, Mouse, Rat. This UBE2S antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2S protein

UBE2S Polyclonal Antibody

ABP60823-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2S protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2S from Human, Mouse, Rat. This UBE2S antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2S protein

UBE2S Rabbit pAb

A4658-100ul 100 ul
EUR 308

UBE2S Rabbit pAb

A4658-200ul 200 ul
EUR 459

UBE2S Rabbit pAb

A4658-20ul 20 ul
EUR 183

UBE2S Rabbit pAb

A4658-50ul 50 ul
EUR 223

UBE2S Polyclonal Conjugated Antibody

C30283 100ul
EUR 397

UBE2S antibody

70R-21113 50 ul
EUR 435
Description: Rabbit polyclonal UBE2S antibody

UBE2S antibody

70R-2798 50 ug
EUR 467
Description: Rabbit polyclonal UBE2S antibody raised against the N terminal of UBE2S

UBE2S Antibody

36429-100ul 100ul
EUR 252

UBE2S antibody

10R-1162 100 ul
EUR 316
Description: Mouse monoclonal UBE2S antibody

UBE2S Antibody

1-CSB-PA623095DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UBE2S Antibody

1-CSB-PA245297
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

UBE2S Antibody

1-CSB-PA142614
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

UBE2S Antibody

1-CSB-PA025477GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

[KO Validated] UBE2S Polyclonal Antibody

30283-100ul 100ul
EUR 252

[KO Validated] UBE2S Polyclonal Antibody

30283-50ul 50ul
EUR 187

[KO Validated] UBE2S Rabbit pAb

A18064-100ul 100 ul
EUR 410

[KO Validated] UBE2S Rabbit pAb

A18064-200ul 200 ul
EUR 571

[KO Validated] UBE2S Rabbit pAb

A18064-20ul 20 ul
EUR 221

[KO Validated] UBE2S Rabbit pAb

A18064-50ul 50 ul
EUR 287

UBE2S Conjugated Antibody

C36429 100ul
EUR 397

anti- UBE2S antibody

FNab09183 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin-conjugating enzyme E2S
  • Uniprot ID: Q16763
  • Gene ID: 27338
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2S

Anti-UBE2S antibody

PAab09183 100 ug
EUR 386

Anti-UBE2S antibody

STJ11100037 100 µl
EUR 413
Description: This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins.

Anti-UBE2S antibody

STJ26022 100 µl
EUR 277
Description: This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins.

Anti-UBE2S antibody

STJ191602 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2S

Ube2s/ Rat Ube2s ELISA Kit

ELI-40410r 96 Tests
EUR 886

UBE2S siRNA

20-abx905912
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2S siRNA

20-abx938810
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2S siRNA

20-abx938811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human)

4-PAE661Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S)

UBE2S Blocking Peptide

33R-6884 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2S antibody, catalog no. 70R-2798

UBE2S cloning plasmid

CSB-CL623095HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtct
  • Show more
Description: A cloning plasmid for the UBE2S gene.

UBE2S cloning plasmid

CSB-CL623095HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atgaactccaacgtggagaacctgcccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaagggaccccatatgctggaggtct
  • Show more
Description: A cloning plasmid for the UBE2S gene.

UBE2S cloning plasmid

CSB-CL623095HU3-10ug 10ug
EUR 297
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtct
  • Show more
Description: A cloning plasmid for the UBE2S gene.

pOTB7-UBE2S Plasmid

PVT14785 2 ug
EUR 325

Anti-E2-EPF / UBE2S antibody

STJ70293 100 µg
EUR 359

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), APC

4-PAE661Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with APC.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), Biotinylated

4-PAE661Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with Biotin.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), Cy3

4-PAE661Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with Cy3.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), FITC

4-PAE661Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with FITC.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), HRP

4-PAE661Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with HRP.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), PE

4-PAE661Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Ala209
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with PE.

Ubiquitin-Conjugating Enzyme E2S (UBE2S) Antibody

20-abx116477
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody

20-abx137303
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody

20-abx132206
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

UBE2S Rabbit Polyclonal Antibody