UBE2Z Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBE2Z Polyclonal Antibody

ES10446-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2Z from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBE2Z Rabbit pAb

A7225-100ul 100 ul
EUR 308

UBE2Z Rabbit pAb

A7225-200ul 200 ul
EUR 459

UBE2Z Rabbit pAb

A7225-20ul 20 ul
EUR 183

UBE2Z Rabbit pAb

A7225-50ul 50 ul
EUR 223

UBE2Z Rabbit pAb

A4951-100ul 100 ul
EUR 308

UBE2Z Rabbit pAb

A4951-200ul 200 ul
EUR 459

UBE2Z Rabbit pAb

A4951-20ul 20 ul Ask for price

UBE2Z Rabbit pAb

A4951-50ul 50 ul Ask for price

UBE2Z antibody

70R-21119 50 ul
EUR 435
Description: Rabbit polyclonal UBE2Z antibody

UBE2Z Antibody

42999-100ul 100ul
EUR 252

UBE2Z Antibody

1-CSB-PA875692ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2Z. Recognizes UBE2Z from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

UBE2Z Antibody

1-CSB-PA875692ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2Z. Recognizes UBE2Z from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

UBE2Z Antibody

1-CSB-PA025487GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2Z. Recognizes UBE2Z from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal UBE2Z Antibody (C-term)

APR04192G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2Z (C-term). This antibody is tested and proven to work in the following applications:

Ube2z/ Rat Ube2z ELISA Kit

ELI-28627r 96 Tests
EUR 886

UBE2Z Conjugated Antibody

C42999 100ul
EUR 397

anti- UBE2Z antibody

FNab09188 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: ubiquitin-conjugating enzyme E2Z
  • Uniprot ID: Q9H832
  • Gene ID: 65264
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2Z

Anti-UBE2Z antibody

PAab09188 100 ug
EUR 386

Anti-UBE2Z antibody

STJ26979 100 µl
EUR 277
Description: This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis.

Anti-UBE2Z antibody

STJ29305 100 µl
EUR 277
Description: This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis.

Anti-UBE2Z antibody

STJ191604 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2Z

UBE2Z siRNA

20-abx905914
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2Z siRNA

20-abx938821
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2Z siRNA

20-abx938822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-UBE2Z

YF-PA20672 50 ug
EUR 363
Description: Mouse polyclonal to UBE2Z

anti-UBE2Z

YF-PA26587 50 ul
EUR 334
Description: Mouse polyclonal to UBE2Z

UBE2Z cloning plasmid

CSB-CL875692HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgtccatttataaggagcctcctccaggaatgttcgttgtacctgatactgttgacatgactaagattcatgcattgatcacaggcccatttgacactccttatgaagggggtttcttcctgttcgtgtttcggtgtccgcccgactatcccatccacccacctcgggtcaaact
  • Show more
Description: A cloning plasmid for the UBE2Z gene.

pCMV-SPORT6-UBE2Z

PVT13204 2 ug
EUR 391

Anti-UBE2Z (4B1)

YF-MA20579 100 ug
EUR 363
Description: Mouse monoclonal to UBE2Z

UBE2Z protein (His tag)

80R-3859 50 ug
EUR 327
Description: Purified recombinant UBE2Z protein (His tag)

UBE2Z ELISA KIT|Human

EF004016 96 Tests
EUR 689

Rat UBE2Z shRNA Plasmid

20-abx989207
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UBE2Z shRNA Plasmid

20-abx982958
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UBE2Z shRNA Plasmid

20-abx962199
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBE2Z Recombinant Protein (Rat)

RP235604 100 ug Ask for price

UBE2Z Recombinant Protein (Human)

RP033772 100 ug Ask for price

UBE2Z Recombinant Protein (Mouse)

RP182744 100 ug Ask for price

Ubiquitin-Conjugating Enzyme E2Z (UBE2Z) Antibody

20-abx116481
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

20-abx005453
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

20-abx003769
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

abx036487-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

20-abx142295
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

abx029369-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

abx029369-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

abx239188-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

20-abx321845
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 Z (UBE2Z) Antibody

20-abx322424
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ube2z ORF Vector (Rat) (pORF)

ORF078536 1.0 ug DNA
EUR 506

UBE2Z ORF Vector (Human) (pORF)

ORF011258 1.0 ug DNA
EUR 95

UBE2Z Rabbit Polyclonal Antibody