VDAC3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

VDAC3 Polyclonal Antibody

ES10469-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VDAC3 Polyclonal Antibody

ES10469-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VDAC3 Rabbit pAb

A10544-100ul 100 ul
EUR 308

VDAC3 Rabbit pAb

A10544-200ul 200 ul
EUR 459

VDAC3 Rabbit pAb

A10544-20ul 20 ul
EUR 183

VDAC3 Rabbit pAb

A10544-50ul 50 ul
EUR 223

VDAC3 Rabbit pAb

A4183-100ul 100 ul
EUR 308

VDAC3 Rabbit pAb

A4183-200ul 200 ul
EUR 459

VDAC3 Rabbit pAb

A4183-20ul 20 ul Ask for price

VDAC3 Rabbit pAb

A4183-50ul 50 ul Ask for price

Polyclonal VDAC3 Antibody (Center)

APR10708G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VDAC3 (Center). This antibody is tested and proven to work in the following applications:

VDAC3 antibody

70R-21249 50 ul
EUR 435
Description: Rabbit polyclonal VDAC3 antibody

VDAC3 Antibody

42830-100ul 100ul
EUR 252

VDAC3 Antibody

DF12499 200ul
EUR 304
Description: VDAC3 antibody detects endogenous levels of VDAC3.

VDAC3 Antibody

1-CSB-PA162897
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

VDAC3 Antibody

1-CSB-PA025827GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VDAC3 antibody

70R-5050 50 ug
EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3

VDAC3 antibody

70R-5051 50 ug
EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3

Vdac3/ Rat Vdac3 ELISA Kit

ELI-51180r 96 Tests
EUR 886

VDAC3 Conjugated Antibody

C42830 100ul
EUR 397

anti- VDAC3 antibody

FNab09388 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: voltage-dependent anion channel 3
  • Uniprot ID: Q9Y277
  • Gene ID: 7419
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3

anti- VDAC3 antibody

FNab09389 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: voltage-dependent anion channel 3
  • Uniprot ID: Q9Y277
  • Gene ID: 7419
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3

Anti-VDAC3 antibody

PAab09389 100 ug
EUR 386

Anti-VDAC3 antibody

STJ26082 100 µl
EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.

Anti-VDAC3 antibody

STJ112562 100 µl
EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.

Anti-VDAC3 antibody

STJ191627 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VDAC3

VDAC3 siRNA

20-abx906017
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VDAC3 siRNA

20-abx939382
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VDAC3 siRNA

20-abx939383
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VDAC3 Blocking Peptide

33R-4733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5051

VDAC3 Blocking Peptide

33R-8339 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5050

VDAC3 cloning plasmid

CSB-CL896484HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtgtaacacaccaacgtactgtgacctaggaaaggctgctaaggatgtcttcaacaaaggatatggctttggcatggtcaagatagacctgaaaaccaagtcttgtagtggagtggaattttctacttctggtcatgcttacactgatacagggaaagcatcaggcaacctaga
  • Show more
Description: A cloning plasmid for the VDAC3 gene.

VDAC3 Blocking Peptide

DF12499-BP 1mg
EUR 195

Anti-VDAC3 (1C6)

YF-MA16053 100 ug
EUR 363
Description: Mouse monoclonal to VDAC3

VDAC3 ELISA KIT|Human

EF004187 96 Tests
EUR 689

Mouse Vdac3 ELISA KIT

ELI-51389m 96 Tests
EUR 865

Bovine VDAC3 ELISA KIT

ELI-44522b 96 Tests
EUR 928

Mouse VDAC3 shRNA Plasmid

20-abx973357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat VDAC3 shRNA Plasmid

20-abx986791
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VDAC3 shRNA Plasmid

20-abx955076
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VDAC3 ELISA KIT

ELI-35275h 96 Tests
EUR 824

VDAC3 Recombinant Protein (Rat)

RP236342 100 ug Ask for price

VDAC3 Recombinant Protein (Human)

RP034300 100 ug Ask for price

VDAC3 Recombinant Protein (Mouse)

RP183728 100 ug Ask for price

VDAC3 Recombinant Protein (Mouse)

RP183731 100 ug Ask for price

Voltage-Dependent Anion Channel 3 (VDAC3) Antibody

20-abx116630
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vdac3 ORF Vector (Mouse) (pORF)

ORF061244 1.0 ug DNA
EUR 506

Vdac3 ORF Vector (Mouse) (pORF)

ORF061245 1.0 ug DNA
EUR 506

Vdac3 ORF Vector (Rat) (pORF)

ORF078782 1.0 ug DNA
EUR 506

VDAC3 ORF Vector (Human) (pORF)

ORF011434 1.0 ug DNA
EUR 95

Vdac3 sgRNA CRISPR Lentivector set (Mouse)

K5012201 3 x 1.0 ug
EUR 339

Vdac3 sgRNA CRISPR Lentivector set (Rat)

K7022001 3 x 1.0 ug
EUR 339

VDAC3 sgRNA CRISPR Lentivector set (Human)

K2608701 3 x 1.0 ug
EUR 339

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody

20-abx003093
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Voltage-dependent anion-selective channel protein 3 (VDAC3) Antibody

20-abx214237
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody

20-abx126771
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody

abx029276-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody

abx029276-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody

abx239389-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5012202 1.0 ug DNA
EUR 154

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5012203 1.0 ug DNA
EUR 154

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5012204 1.0 ug DNA
EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7022002 1.0 ug DNA
EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7022003 1.0 ug DNA
EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7022004 1.0 ug DNA
EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2608702 1.0 ug DNA
EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2608703 1.0 ug DNA
EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2608704 1.0 ug DNA
EUR 154

VDAC3 Protein Vector (Mouse) (pPB-C-His)

PV244974 500 ng
EUR 603

VDAC3 Protein Vector (Mouse) (pPB-N-His)

PV244975 500 ng
EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-HA)

PV244976 500 ng
EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-His)

PV244977 500 ng
EUR 603

VDAC3 Protein Vector (Mouse) (pPB-C-His)

PV244978 500 ng
EUR 603

VDAC3 Rabbit Polyclonal Antibody