VSX1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

VSX1 Polyclonal Antibody
ES10661-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VSX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
VSX1 Polyclonal Antibody
ABP60905-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein
VSX1 Polyclonal Antibody
ABP60905-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein
VSX1 Polyclonal Antibody
ABP60905-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein
VSX1 Rabbit pAb
A9800-100ul 100 ul
EUR 308
VSX1 Rabbit pAb
A9800-200ul 200 ul
EUR 459
VSX1 Rabbit pAb
A9800-20ul 20 ul
EUR 183
VSX1 Rabbit pAb
A9800-50ul 50 ul
EUR 223
VSX1 Antibody
ABD13315 100 ug
EUR 438
VSX1 Antibody
ABD2476 100 ug
EUR 438
VSX1 Antibody
43597-100ul 100ul
EUR 252
VSX1 Antibody
DF2476 200ul
EUR 304
Description: VSX1 antibody detects endogenous levels of total VSX1.
VSX1 Antibody
1-CSB-PA025938ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VSX1. Recognizes VSX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
Polyclonal Vsx1 Antibody - C-terminal region
APR13993G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - C-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal Vsx1 antibody - N-terminal region
APR13994G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - N-terminal region. This antibody is tested and proven to work in the following applications:
VSX1 Conjugated Antibody
C43597 100ul
EUR 397
anti- VSX1 antibody
FNab09458 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: visual system homeobox 1
  • Uniprot ID: Q9NZR4
  • Gene ID: 30813
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against VSX1
Anti-VSX1 antibody
PAab09458 100 ug
EUR 412
Anti-VSX1 antibody
STJ111842 100 µl
EUR 277
Description: The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described.
Anti-VSX1 antibody
STJ191819 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VSX1
VSX1 siRNA
20-abx939583
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSX1 siRNA
20-abx939584
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSX1 cloning plasmid
CSB-CL025938HU-10ug 10ug
EUR 418
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atgaccggccgggactcgctttccgacgggcgcactagcagcagggcgctggtgcctggcggttcccctaggggctcgcgcccccggggcttcgccatcacggacctgctgggcttggaggccgagctgccggcgcccgctggcccaggacagggatctggctgcgagggtccgg
  • Show more
Description: A cloning plasmid for the VSX1 gene.
VSX1 Blocking Peptide
DF2476-BP 1mg
EUR 195
Rabbit Visual system homeobox 1(VSX1) ELISA kit
E04V0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Visual system homeobox 1(VSX1) ELISA kit
E04V0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Visual system homeobox 1(VSX1) ELISA kit
E04V0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse VSX1 shRNA Plasmid
20-abx980190
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VSX1 ELISA KIT|Human
EF004238 96 Tests
EUR 689
Human VSX1 shRNA Plasmid
20-abx959340
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VSX1 Recombinant Protein (Human)
RP044797 100 ug Ask for price

VSX1 Rabbit Polyclonal Antibody