VSX1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
VSX1 Polyclonal Antibody |
ES10661-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VSX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VSX1 Polyclonal Antibody |
ABP60905-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein |
VSX1 Polyclonal Antibody |
ABP60905-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein |
VSX1 Polyclonal Antibody |
ABP60905-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VSX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VSX1 from Human, Mouse. This VSX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSX1 protein |
VSX1 Rabbit pAb |
A9800-100ul |
Abclonal |
100 ul |
EUR 308 |
VSX1 Rabbit pAb |
A9800-200ul |
Abclonal |
200 ul |
EUR 459 |
VSX1 Rabbit pAb |
A9800-20ul |
Abclonal |
20 ul |
EUR 183 |
VSX1 Rabbit pAb |
A9800-50ul |
Abclonal |
50 ul |
EUR 223 |
VSX1 Antibody |
43597-100ul |
SAB |
100ul |
EUR 252 |
VSX1 Antibody |
DF2476 |
Affbiotech |
200ul |
EUR 304 |
Description: VSX1 antibody detects endogenous levels of total VSX1. |
VSX1 Antibody |
1-CSB-PA025938ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VSX1. Recognizes VSX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Polyclonal Vsx1 Antibody - C-terminal region |
APR13993G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal Vsx1 antibody - N-terminal region |
APR13994G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
VSX1 Conjugated Antibody |
C43597 |
SAB |
100ul |
EUR 397 |
anti- VSX1 antibody |
FNab09458 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:1000
- Immunogen: visual system homeobox 1
- Uniprot ID: Q9NZR4
- Gene ID: 30813
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against VSX1 |
Anti-VSX1 antibody |
STJ111842 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-VSX1 antibody |
STJ191819 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VSX1 |
VSX1 siRNA |
20-abx939583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VSX1 siRNA |
20-abx939584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VSX1 cloning plasmid |
CSB-CL025938HU-10ug |
Cusabio |
10ug |
EUR 418 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1098
- Sequence: atgaccggccgggactcgctttccgacgggcgcactagcagcagggcgctggtgcctggcggttcccctaggggctcgcgcccccggggcttcgccatcacggacctgctgggcttggaggccgagctgccggcgcccgctggcccaggacagggatctggctgcgagggtccgg
- Show more
|
Description: A cloning plasmid for the VSX1 gene. |
VSX1 Blocking Peptide |
DF2476-BP |
Affbiotech |
1mg |
EUR 195 |
Rabbit Visual system homeobox 1(VSX1) ELISA kit |
E04V0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Visual system homeobox 1(VSX1) ELISA kit |
E04V0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Visual system homeobox 1(VSX1) ELISA kit |
E04V0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse VSX1 shRNA Plasmid |
20-abx980190 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VSX1 shRNA Plasmid |
20-abx959340 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VSX1 Recombinant Protein (Human) |
RP044797 |
ABM |
100 ug |
Ask for price |
VSX1 Rabbit Polyclonal Antibody