ZBTB6 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ZBTB6 Polyclonal Antibody |
ABP60956-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ZBTB6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBTB6 from Human, Mouse. This ZBTB6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBTB6 protein |
ZBTB6 Polyclonal Antibody |
ES10481-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ZBTB6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZBTB6 Polyclonal Antibody |
ES10481-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ZBTB6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZBTB6 Rabbit pAb |
A15136-100ul |
Abclonal |
100 ul |
EUR 308 |
ZBTB6 Rabbit pAb |
A15136-200ul |
Abclonal |
200 ul |
EUR 459 |
ZBTB6 Rabbit pAb |
A15136-20ul |
Abclonal |
20 ul |
EUR 183 |
ZBTB6 Rabbit pAb |
A15136-50ul |
Abclonal |
50 ul |
EUR 223 |
ZBTB6 Antibody |
25245-100ul |
SAB |
100ul |
EUR 390 |
ZBTB6 Antibody |
47479-100ul |
SAB |
100ul |
EUR 252 |
ZBTB6 Antibody |
1-CSB-PA621889LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
ZBTB6 antibody |
70R-8281 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ZBTB6 antibody |
ZBTB6 Polyclonal Antibody, Biotin Conjugated |
A61843 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ZBTB6 Polyclonal Antibody, FITC Conjugated |
A61844 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ZBTB6 Polyclonal Antibody, HRP Conjugated |
A61845 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ZBTB6 Conjugated Antibody |
C47479 |
SAB |
100ul |
EUR 397 |
ZBTB6 Antibody (HRP) |
20-abx307019 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ZBTB6 Antibody (FITC) |
20-abx307020 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ZBTB6 Antibody (Biotin) |
20-abx307021 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-ZBTB6 antibody |
STJ191639 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ZBTB6 |
ZBTB6 siRNA |
20-abx940222 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZBTB6 siRNA |
20-abx940223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ZBTB6 |
YF-PA17205 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ZBTB6 |
ZBTB6 Antibody, HRP conjugated |
1-CSB-PA621889LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ZBTB6 Antibody, FITC conjugated |
1-CSB-PA621889LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ZBTB6 Antibody, Biotin conjugated |
1-CSB-PA621889LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ZBTB6 Blocking Peptide |
33R-5593 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZBTB6 antibody, catalog no. 70R-8281 |
ZBTB6 cloning plasmid |
CSB-CL621889HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1275
- Sequence: atggctgctgagtctgatgttctgcatttccagtttgaacagcaaggagatgtggtcttgcagaaaatgaatcttttgagacagcagaatttattttgtgatgtatcaatttacattaatgacactgagttccaggggcacaaggtgattttggctgcttgctccacttttatga
- Show more
|
Description: A cloning plasmid for the ZBTB6 gene. |
Anti-ZBTB6 (2E12) |
YF-MA17479 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ZBTB6 |
Human ZBTB6 shRNA Plasmid |
20-abx957341 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ZBTB6 shRNA Plasmid |
20-abx982511 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ZBTB6 Recombinant Protein (Rat) |
RP237899 |
ABM |
100 ug |
Ask for price |
ZBTB6 Recombinant Protein (Human) |
RP035179 |
ABM |
100 ug |
Ask for price |
ZBTB6 Recombinant Protein (Mouse) |
RP186281 |
ABM |
100 ug |
Ask for price |
Zbtb6 ORF Vector (Mouse) (pORF) |
ORF062095 |
ABM |
1.0 ug DNA |
EUR 506 |
Zbtb6 ORF Vector (Rat) (pORF) |
ORF079301 |
ABM |
1.0 ug DNA |
EUR 506 |
ZBTB6 ORF Vector (Human) (pORF) |
ORF011727 |
ABM |
1.0 ug DNA |
EUR 95 |
Zbtb6 sgRNA CRISPR Lentivector set (Mouse) |
K4975901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zbtb6 sgRNA CRISPR Lentivector set (Rat) |
K6137901 |
ABM |
3 x 1.0 ug |
EUR 339 |
ZBTB6 sgRNA CRISPR Lentivector set (Human) |
K2660701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4975902 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4975903 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4975904 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6137902 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6137903 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6137904 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2660702 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2660703 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2660704 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBTB6 Protein Vector (Mouse) (pPB-C-His) |
PV248378 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Mouse) (pPB-N-His) |
PV248379 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Mouse) (pPM-C-HA) |
PV248380 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Mouse) (pPM-C-His) |
PV248381 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Rat) (pPB-C-His) |
PV317202 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Rat) (pPB-N-His) |
PV317203 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Rat) (pPM-C-HA) |
PV317204 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Rat) (pPM-C-His) |
PV317205 |
ABM |
500 ng |
EUR 603 |
ZBTB6 Protein Vector (Human) (pPB-C-His) |
PV046905 |
ABM |
500 ng |
EUR 329 |
ZBTB6 Protein Vector (Human) (pPB-N-His) |
PV046906 |
ABM |
500 ng |
EUR 329 |
ZBTB6 Protein Vector (Human) (pPM-C-HA) |
PV046907 |
ABM |
500 ng |
EUR 329 |
ZBTB6 Protein Vector (Human) (pPM-C-His) |
PV046908 |
ABM |
500 ng |
EUR 329 |
Zbtb6 3'UTR Luciferase Stable Cell Line |
TU122494 |
ABM |
1.0 ml |
Ask for price |
ZBTB6 3'UTR GFP Stable Cell Line |
TU078713 |
ABM |
1.0 ml |
EUR 1521 |
Zbtb6 3'UTR GFP Stable Cell Line |
TU172494 |
ABM |
1.0 ml |
Ask for price |
Zbtb6 3'UTR Luciferase Stable Cell Line |
TU223571 |
ABM |
1.0 ml |
Ask for price |
ZBTB6 3'UTR Luciferase Stable Cell Line |
TU028713 |
ABM |
1.0 ml |
EUR 1521 |
Zbtb6 3'UTR GFP Stable Cell Line |
TU273571 |
ABM |
1.0 ml |
Ask for price |
Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody |
abx038071-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody |
abx029744-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody |
abx029744-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody |
20-abx302777 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
ZBTB6 Rabbit Polyclonal Antibody