ZHX3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ZHX3 Polyclonal Antibody |
ABP60968-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ZHX3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ZHX3 from Human, Mouse, Rat. This ZHX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZHX3 protein |
ZHX3 Polyclonal Antibody |
ES10492-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ZHX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZHX3 Polyclonal Antibody |
ES10492-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ZHX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZHX3 Antibody |
47486-100ul |
SAB |
100ul |
EUR 252 |
Zhx3 antibody |
70R-8211 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Zhx3 antibody |
ZHX3 antibody |
70R-9570 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ZHX3 antibody |
ZHX3 antibody |
70R-9571 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ZHX3 antibody |
ZHX3 Conjugated Antibody |
C47486 |
SAB |
100ul |
EUR 397 |
Anti-ZHX3 antibody |
STJ191650 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ZHX3 |
ZHX3 siRNA |
20-abx906181 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZHX3 siRNA |
20-abx940480 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZHX3 siRNA |
20-abx940481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ZHX3 |
YF-PA17723 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ZHX3 |
ZHX3 Blocking Peptide |
33R-2062 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9571 |
ZHX3 Blocking Peptide |
33R-2763 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9570 |
Zhx3 Blocking Peptide |
33R-6698 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Zhx3 antibody, catalog no. 70R-8211 |
ZHX3 cloning plasmid |
CSB-CL872496HU-10ug |
Cusabio |
10ug |
EUR 924 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2910
- Sequence: atggccagcaagaggaaatccaccacaccatgcatgatcccagtgaagactgtggtgttgcaagatgccagcatggaggcccagcccgctgagaccttgcctgaaggaccccagcaggatctgcccccagaagcatctgctgccagcagtgaggcagcacagaaccccagcagta
- Show more
|
Description: A cloning plasmid for the ZHX3 gene. |
Anti-ZHX3 (1D9) |
YF-MA17797 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ZHX3 |
Rat ZHX3 shRNA Plasmid |
20-abx989683 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ZHX3 shRNA Plasmid |
20-abx957961 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ZHX3 shRNA Plasmid |
20-abx983454 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Zhx3 ORF Vector (Mouse) (pORF) |
ORF062687 |
ABM |
1.0 ug DNA |
EUR 506 |
Zhx3 ORF Vector (Rat) (pORF) |
ORF079561 |
ABM |
1.0 ug DNA |
EUR 506 |
ZHX3 ORF Vector (Human) (pORF) |
ORF011815 |
ABM |
1.0 ug DNA |
EUR 95 |
Zhx3 sgRNA CRISPR Lentivector set (Rat) |
K7490101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ZHX3 sgRNA CRISPR Lentivector set (Human) |
K2676901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zhx3 sgRNA CRISPR Lentivector set (Mouse) |
K4257401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7490102 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7490103 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7490104 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2676902 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2676903 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2676904 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4257402 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4257403 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4257404 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 Protein Vector (Mouse) (pPB-C-His) |
PV250746 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPB-N-His) |
PV250747 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPM-C-HA) |
PV250748 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPM-C-His) |
PV250749 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Rat) (pPB-C-His) |
PV318242 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPB-N-His) |
PV318243 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPM-C-HA) |
PV318244 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPM-C-His) |
PV318245 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Human) (pPB-C-His) |
PV047257 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPB-N-His) |
PV047258 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPM-C-HA) |
PV047259 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPM-C-His) |
PV047260 |
ABM |
500 ng |
EUR 329 |
Zhx3 3'UTR Luciferase Stable Cell Line |
TU122968 |
ABM |
1.0 ml |
Ask for price |
ZHX3 3'UTR GFP Stable Cell Line |
TU078881 |
ABM |
1.0 ml |
EUR 4617 |
Zhx3 3'UTR GFP Stable Cell Line |
TU172968 |
ABM |
1.0 ml |
Ask for price |
Zhx3 3'UTR Luciferase Stable Cell Line |
TU223864 |
ABM |
1.0 ml |
Ask for price |
ZHX3 3'UTR Luciferase Stable Cell Line |
TU028881 |
ABM |
1.0 ml |
EUR 4617 |
Zhx3 3'UTR GFP Stable Cell Line |
TU273864 |
ABM |
1.0 ml |
Ask for price |
ZHX3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV667519 |
ABM |
1.0 ug DNA |
EUR 1355 |
ZHX3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV667523 |
ABM |
1.0 ug DNA |
EUR 1355 |
ZHX3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV667524 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ZHX3 Rabbit Polyclonal Antibody