ZHX3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ZHX3 Polyclonal Antibody

ABP60968-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZHX3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZHX3 from Human, Mouse, Rat. This ZHX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZHX3 protein

ZHX3 Polyclonal Antibody

ES10492-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZHX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZHX3 Polyclonal Antibody

ES10492-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZHX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZHX3   Antibody

47486-100ul 100ul
EUR 252

Zhx3 antibody

70R-8211 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Zhx3 antibody

ZHX3 antibody

70R-9570 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZHX3 antibody

ZHX3 antibody

70R-9571 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZHX3 antibody

Zhx3/ Rat Zhx3 ELISA Kit

ELI-22600r 96 Tests
EUR 886

ZHX3   Conjugated Antibody

C47486 100ul
EUR 397

Anti-ZHX3 antibody

STJ191650 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZHX3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17723 50 ug
EUR 363
Description: Mouse polyclonal to ZHX3

ZHX3 Blocking Peptide

33R-2062 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9571

ZHX3 Blocking Peptide

33R-2763 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9570

Zhx3 Blocking Peptide

33R-6698 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Zhx3 antibody, catalog no. 70R-8211

ZHX3 cloning plasmid

CSB-CL872496HU-10ug 10ug
EUR 924
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2910
  • Sequence: atggccagcaagaggaaatccaccacaccatgcatgatcccagtgaagactgtggtgttgcaagatgccagcatggaggcccagcccgctgagaccttgcctgaaggaccccagcaggatctgcccccagaagcatctgctgccagcagtgaggcagcacagaaccccagcagta
  • Show more
Description: A cloning plasmid for the ZHX3 gene.

Anti-ZHX3 (1D9)

YF-MA17797 100 ug
EUR 363
Description: Mouse monoclonal to ZHX3

Rat ZHX3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZHX3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ZHX3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Zhx3 ORF Vector (Mouse) (pORF)

ORF062687 1.0 ug DNA
EUR 506

Zhx3 ORF Vector (Rat) (pORF)

ORF079561 1.0 ug DNA
EUR 506

ZHX3 ORF Vector (Human) (pORF)

ORF011815 1.0 ug DNA
EUR 95

Zhx3 sgRNA CRISPR Lentivector set (Rat)

K7490101 3 x 1.0 ug
EUR 339

ZHX3 sgRNA CRISPR Lentivector set (Human)

K2676901 3 x 1.0 ug
EUR 339

Zhx3 sgRNA CRISPR Lentivector set (Mouse)

K4257401 3 x 1.0 ug
EUR 339

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7490102 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7490103 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7490104 1.0 ug DNA
EUR 154

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2676902 1.0 ug DNA
EUR 154

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2676903 1.0 ug DNA
EUR 154

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2676904 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4257402 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4257403 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4257404 1.0 ug DNA
EUR 154

ZHX3 Protein Vector (Mouse) (pPB-C-His)

PV250746 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPB-N-His)

PV250747 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPM-C-HA)

PV250748 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPM-C-His)

PV250749 500 ng
EUR 1065

ZHX3 Protein Vector (Rat) (pPB-C-His)

PV318242 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPB-N-His)

PV318243 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPM-C-HA)

PV318244 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPM-C-His)

PV318245 500 ng
EUR 1166

ZHX3 Protein Vector (Human) (pPB-C-His)

PV047257 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPB-N-His)

PV047258 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPM-C-HA)

PV047259 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPM-C-His)

PV047260 500 ng
EUR 329

Zhx3 3'UTR Luciferase Stable Cell Line

TU122968 1.0 ml Ask for price

ZHX3 3'UTR GFP Stable Cell Line

TU078881 1.0 ml
EUR 4617

Zhx3 3'UTR GFP Stable Cell Line

TU172968 1.0 ml Ask for price

Zhx3 3'UTR Luciferase Stable Cell Line

TU223864 1.0 ml Ask for price

ZHX3 3'UTR Luciferase Stable Cell Line

TU028881 1.0 ml
EUR 4617

Zhx3 3'UTR GFP Stable Cell Line

TU273864 1.0 ml Ask for price

ZHX3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667519 1.0 ug DNA
EUR 1355

ZHX3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667523 1.0 ug DNA
EUR 1355

ZHX3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667524 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ZHX3 Rabbit Polyclonal Antibody