ZNF71 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ZNF71 Polyclonal Antibody

ES10657-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZNF71 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZNF71 Polyclonal Antibody

ES10657-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZNF71 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZNF71 Antibody

44787-100ul 100ul
EUR 252

ZNF71 Antibody

44787-50ul 50ul
EUR 187

ZNF71 Antibody

1-CSB-PA885697LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ZNF71 Antibody

DF2474 200ul
EUR 304
Description: ZNF71 antibody detects endogenous levels of total ZNF71.

ZNF71 antibody

70R-8360 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZNF71 antibody

ZNF71 antibody

70R-8361 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZNF71 antibody

ZNF71 Antibody

ABD2474 100 ug
EUR 438

ZNF71 Polyclonal Antibody, HRP Conjugated

A67855 100 µg
EUR 570.55
Description: Ask the seller for details

ZNF71 Polyclonal Antibody, FITC Conjugated

A67856 100 µg
EUR 570.55
Description: The best epigenetics products

ZNF71 Polyclonal Antibody, Biotin Conjugated

A67857 100 µg
EUR 570.55
Description: kits suitable for this type of research

ZNF71 Conjugated Antibody

C44787 100ul
EUR 397

anti- ZNF71 antibody

FNab09732 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: zinc finger protein 71
  • Uniprot ID: Q9NQZ8
  • Gene ID: 58491
  • Research Area: Metabolism
Description: Antibody raised against ZNF71

Anti-ZNF71 antibody

PAab09732 100 ug
EUR 412

Anti-ZNF71 antibody

STJ191815 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZNF71

ZNF71 siRNA

20-abx941049
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ZNF71

YF-PA20320 50 ul
EUR 363
Description: Mouse polyclonal to ZNF71

anti-ZNF71

YF-PA20321 100 ug
EUR 403
Description: Rabbit polyclonal to ZNF71

ZNF71 Antibody, HRP conjugated

1-CSB-PA885697LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ZNF71 Antibody, FITC conjugated

1-CSB-PA885697LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ZNF71 Antibody, Biotin conjugated

1-CSB-PA885697LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ZNF71 Blocking Peptide

33R-7834 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF71 antibody, catalog no. 70R-8361

ZNF71 Blocking Peptide

33R-6133 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF71 antibody, catalog no. 70R-8360

ZNF71 Blocking Peptide

DF2474-BP 1mg
EUR 195

ZNF71 cloning plasmid

CSB-CL885697HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1470
  • Sequence: atgaaagagttggatccaaagaatgacatttcggaagacaagctctccgttgttggggaggccacggggggacccacgaggaatggtgccaggggtcctggctcagaaggagtgtgggaaccaggcagctggccagagaggccgcggggagatgcaggtgcagagtgggagccat
  • Show more
Description: A cloning plasmid for the ZNF71 gene.

Anti-ZNF71 (3F4)

YF-MA19128 100 ug
EUR 363
Description: Mouse monoclonal to ZNF71

ZNF71 Rabbit Polyclonal Antibody