ACTB Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ACTB Polyclonal Antibody |
ABP57696-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ACTB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein |
ACTB Polyclonal Antibody |
ABP57696-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ACTB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein |
ACTB Polyclonal Antibody |
ABP57696-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ACTB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ACTB from Human, Mouse, Rat. This ACTB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTB protein |
ACTB Polyclonal Antibody |
A52074 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Actb Polyclonal Antibody |
A53186 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Actin Beta (ACTb) ELISA Kit |
DLR-ACTb-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Actin Beta (ACTb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Actin Beta (ACTb) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Actin Beta (ACTb) ELISA Kit |
RD-ACTb-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Actin Beta (ACTb) ELISA Kit |
RDR-ACTb-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
ACTB Rabbit pAb |
AC006 |
Abclonal |
50 ul |
EUR 176 |
ACTB Rabbit mAb |
AC026 |
Abclonal |
50 ul |
EUR 204 |
ACTB Rabbit mAb |
AC038 |
Abclonal |
50 ul |
EUR 176 |
Polyclonal ACTB / Beta Actin Antibody |
APR02611G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin . This antibody is tested and proven to work in the following applications: |
ACTB Polyclonal Antibody, HRP Conjugated |
A52075 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ACTB Polyclonal Antibody, FITC Conjugated |
A52076 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ACTB Polyclonal Antibody, Biotin Conjugated |
A52077 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Actb Polyclonal Antibody, HRP Conjugated |
A53187 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Actb Polyclonal Antibody, FITC Conjugated |
A53188 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Actb Polyclonal Antibody, Biotin Conjugated |
A53189 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Rabbit ACTb ELISA Kit |
ERTA0406 |
Abclonal |
96Tests |
EUR 521 |
ACTB Antibody |
35532-100ul |
SAB |
100ul |
EUR 252 |
ACTB antibody |
10R-10271 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal ACTB antibody |
ACTB antibody |
10R-10272 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal ACTB antibody |
ACTB antibody |
10R-1242 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal ACTB antibody |
ACTB antibody |
70R-15285 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody |
ACTB antibody |
70R-15472 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody |
ACTB antibody |
70R-15561 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ACTB antibody |
ACTB Antibody |
1-CSB-PA000350 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, X. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:3000IHC:1:200 |
ACTB Antibody |
1-CSB-PA000813 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/1000-1/4000.IHC:1/100-1/300.ELISA:1/20000 |
ACTB Antibody |
1-CSB-PA001207GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
ACTB Antibody |
1-CSB-PA001207NJ01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
ACTB Antibody |
CSB-PA551635- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
ACTB Antibody |
CSB-PA551635-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Purified Rabbit polyclonal in PBS(pH 7.4) containing with 0.02% sodium azide and 50% glycerol. Affinity purification
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
ACTB Antibody |
1-CSB-PA244513 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:500-1:2000 |
ACTB Antibody |
CSB-PA284599- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
ACTB Antibody |
CSB-PA284599-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
Actb Antibody |
1-CSB-PA07675A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Actb. Recognizes Actb from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
ACTB Antibody |
1-CSB-PA01629A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:100-1:500, IF:1:50-1:200 |
HRP-conjugated ACTB Rabbit mAb |
AC028 |
Abclonal |
50 ul |
EUR 223 |
ACTB Conjugated Antibody |
C35532 |
SAB |
100ul |
EUR 397 |
ACTB antibody (HRP) |
60R-2233 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (HRP) |
ACTB antibody (FITC) |
60R-2234 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (FITC) |
ACTB antibody (biotin) |
60R-2235 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (biotin) |
ACTB antibody (biotin) |
60R-1690 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (biotin) |
ACTB antibody (FITC) |
60R-1691 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (FITC) |
ACTB antibody (HRP) |
60R-1692 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTB antibody (HRP) |
Anti-ACTB antibody |
STJ113532 |
St John's Laboratory |
100 µl |
EUR 280 |
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. |
Anti-ACTB antibody |
STJ116402 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. |
Anti-ACTB antibody |
STJ192006 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ACTB |
Polyclonal ACTB / Beta Actin Antibody (aa359-368) |
APR02204G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (aa359-368). This antibody is tested and proven to work in the following applications: |
Polyclonal ACTB / Beta Actin Antibody (C-Terminus) |
APR02335G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal ACTB / Beta Actin Antibody (N-Terminus) |
APR02419G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal ACTB / Beta Actin Antibody (N-Terminus) |
APR02500G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal ACTB / Beta Actin Antibody (C-Terminus) |
APR02506G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal ACTB / Beta Actin Antibody (aa2-16) |
APR02825G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTB / Beta Actin (aa2-16). This antibody is tested and proven to work in the following applications: |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse) |
4-CAB340Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb) |
Polyclonal Actin (ACTB/ACTC) Antibody (N-term) |
APR04039G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Actin (ACTB/ACTC) (N-term). This antibody is tested and proven to work in the following applications: |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse) |
4-PAB340Mi01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb) |
Rabbit Anti-ACTB monoclonal antibody, clone KG64-21 |
DCABH-201802 |
Creative Diagnostics |
100 ul |
EUR 777 |
ACTB siRNA |
20-abx900145 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTB siRNA |
20-abx906619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTB siRNA |
20-abx906620 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTB-1003 |
B4904-10 |
ApexBio |
10 mg |
EUR 601 |
ACTB-1003 |
B4904-100 |
ApexBio |
100 mg |
EUR 2364 |
ACTB-1003 |
B4904-5 |
ApexBio |
5 mg |
EUR 435 |
ACTB-1003 |
B4904-50 |
ApexBio |
50 mg |
EUR 1703 |
Beta Actin (ACTB) Antibody |
20-abx118009 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx129303 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Beta Actin (ACTB) Antibody |
20-abx109486 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx109487 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx109488 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx110772 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159309 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159310 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159311 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159312 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
abx159313-100ul |
Abbexa |
100 ul |
EUR 356 |
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
20-abx159315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
abx159316-100ul |
Abbexa |
100 ul |
EUR 356 |
- Shipped within 5-10 working days.
|
Actin Beta (ACTB) Antibody |
abx159317-100ul |
Abbexa |
100 ul |
EUR 356 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx132139 |
Abbexa |
-
EUR 328.00
-
EUR 84.00
-
EUR 746.00
-
EUR 439.00
-
EUR 112.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
20 ug
|
- Shipped within 5-7 working days.
|
Beta Actin (ACTB) Antibody |
20-abx132249 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133823 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133824 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133825 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133826 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133827 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133829 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx133830 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx037900-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx037901-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx009628 |
Abbexa |
-
EUR 258.00
-
EUR 356.00
-
EUR 175.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx010349-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx010457-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025152-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025189-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025190-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025190-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025616-400ul |
Abbexa |
400 ul |
EUR 551 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx025616-80l |
Abbexa |
80 µl |
EUR 321 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx005571 |
Abbexa |
-
EUR 314.00
-
EUR 411.00
-
EUR 258.00
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx005572 |
Abbexa |
-
EUR 314.00
-
EUR 411.00
-
EUR 258.00
|
|
- Shipped within 5-10 working days.
|
Actin (ACTB / ACTC) Antibody |
abx028417-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Actin (ACTB / ACTC) Antibody |
abx028417-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx018070-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx018071-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx018342-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx019022-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx019023-100ug |
Abbexa |
100 ug |
EUR 356 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx019024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx326896 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTB / POTEKP / ACTG1 Antibody |
20-abx328332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx330106 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx332202-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx332408-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx448540-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody |
20-abx241125 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
abx230869-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody |
abx230870-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody |
abx230871-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody |
abx230872-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody |
abx230873-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Actin Beta (ACTB) Antibody |
20-abx249494 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody |
20-abx210097 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTB/POTEKP/ACTG1 Antibody |
1-CSB-PA000809 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ACTB/POTEKP/ACTG1. Recognizes ACTB/POTEKP/ACTG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
Actb Antibody, HRP conjugated |
1-CSB-PA07675B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Actb Antibody, FITC conjugated |
1-CSB-PA07675C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Actb Antibody, Biotin conjugated |
1-CSB-PA07675D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Actb. Recognizes Actb from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ACTB Antibody, HRP conjugated |
1-CSB-PA01629B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ACTB Antibody, FITC conjugated |
1-CSB-PA01629C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ACTB Antibody, Biotin conjugated |
1-CSB-PA01629D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTB. Recognizes ACTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-ACTB mAb antibody |
STJ11100960 |
St John's Laboratory |
100 µl |
EUR 240 |
Description: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. |Put 5ul AC026 into 45 ul buffer(with 50% glycerol), diluted 1:10,000 for using. The diluted antibody can be stored at -20‚ÑÉ without aliquot. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC |
4-CAB340Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-CAB340Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Biotin. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Cy3 |
4-CAB340Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Cy3. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), FITC |
4-CAB340Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with FITC. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), HRP |
4-CAB340Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with HRP. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), PE |
4-CAB340Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with PE. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC |
4-PAB340Mi01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB340Mi01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Biotin. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB340Mi01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with Cy3. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB340Mi01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with FITC. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB340Mi01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with HRP. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), PE |
4-PAB340Mi01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with PE. |
Rabbit Actin, cytoplasmic 1, ACTB ELISA KIT |
ELI-24529Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Beta Actin (ACTB) Antibody Pair |
abx117501-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (Biotin) |
20-abx105088 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (Biotin) |
20-abx105089 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (FITC) |
20-abx106505 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (FITC) |
20-abx106506 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (HRP) |
20-abx107922 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (HRP) |
20-abx107923 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Beta Actin (ACTB) Antibody (HRP) |
20-abx017267 |
Abbexa |
-
EUR 384.00
-
EUR 606.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Actin Beta (ACTb) Antibody Pair |
20-abx370254 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Beta Actin (ACTB) Antibody (ALP) |
abx445183-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (APC) |
abx445184-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (Biotin) |
abx445185-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (FITC) |
abx445186-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (HRP) |
abx445187-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (PerCP) |
abx445189-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (RPE) |
abx445190-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (Streptavidin) |
abx445191-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
F-Actin (ACTB/ACTG1) Antibody |
abx414711-05mg |
Abbexa |
0.5 mg |
EUR 662 |
|
F-Actin (ACTB/ACTG1) Antibody |
abx414712-50ug |
Abbexa |
50 ug |
EUR 328 |
|
Anti-beta Actin/ACTB Antibody |
PA1872 |
BosterBio |
100ug/vial |
EUR 294 |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-CAB340Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC-Cy7. |
Actin Beta (ACTb) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB340Mi01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTb (Met1~Phe375)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Actin Beta (ACTb). This antibody is labeled with APC-Cy7. |
ACTB Mouse mAb |
AC004 |
Abclonal |
50 ul |
EUR 176 |
ACTB cloning plasmid |
CSB-CL001207HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1083
- Sequence: atgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacg
- Show more
|
Description: A cloning plasmid for the ACTB gene. |
ACTB cloning plasmid |
CSB-CL001207HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1128
- Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
- Show more
|
Description: A cloning plasmid for the ACTB gene. |
ACTB cloning plasmid |
CSB-CL001207HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1128
- Sequence: atggatgatgatatcgccgcgctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggccc
- Show more
|
Description: A cloning plasmid for the ACTB gene. |
SEAP (ActB, Puro) |
LVP1221 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 349 |
Description: Lentivirus express SEAP under ActB promoter, containing puromycin selection. |
Actin Beta (ACTb) Monoclonal Antibody (Human) |
4-CAB340Hu22 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Actin Beta (ACTb) |
Beta Actin (ACTB) Antibody (ATTO 390) |
abx445175-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 488) |
abx445176-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 565) |
abx445177-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 594) |
abx445178-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 633) |
abx445179-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 655) |
abx445180-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 680) |
abx445181-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Beta Actin (ACTB) Antibody (ATTO 700) |
abx445182-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Actin Beta (ACTb) Monoclonal Antibody (Human) |
4-MAB340Hu21 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Actin Beta (ACTb) |
Rat ACTB shRNA Plasmid |
20-abx986737 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ACTb ELISA Kit |
EHA0406 |
Abclonal |
96Tests |
EUR 521 |
Goat ACTb ELISA Kit |
EGTA0406 |
Abclonal |
96Tests |
EUR 521 |
Actin, cytoplasmic 1/ACTB |
E21-E15 |
EnoGene |
10ug |
EUR 343 |
Canine ACTb ELISA Kit |
ECA0406 |
Abclonal |
96Tests |
EUR 521 |
Chicken ACTb ELISA Kit |
ECKA0406 |
Abclonal |
96Tests |
EUR 521 |
ACTB Rabbit Polyclonal Antibody