ADAM8 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ADAM8 Polyclonal Antibody
ES10861-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADAM8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ADAM8 Polyclonal Antibody
ABP57712-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
ABP57712-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
ABP57712-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
A69791 100 ?g
EUR 628.55
Description: The best epigenetics products
ADAM8 Rabbit pAb
A9578-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A9578-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A9578-20ul 20 ul Ask for price
ADAM8 Rabbit pAb
A9578-50ul 50 ul Ask for price
ADAM8 Rabbit pAb
A10497-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A10497-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A10497-20ul 20 ul
EUR 183
ADAM8 Rabbit pAb
A10497-50ul 50 ul
EUR 223
ADAM8 Rabbit pAb
A15022-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A15022-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A15022-20ul 20 ul
EUR 183
ADAM8 Rabbit pAb
A15022-50ul 50 ul
EUR 223
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Hu-48T 48T
EUR 479
  • Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Hu-96T 96T
EUR 621
  • Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Mu-48T 48T
EUR 489
  • Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Mu-96T 96T
EUR 635
  • Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Ra-48T 48T
EUR 508
  • Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Ra-96T 96T
EUR 661
  • Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Hu-48Tests 48 Tests
EUR 478
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Hu-96Tests 96 Tests
EUR 662
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Mu-48Tests 48 Tests
EUR 489
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Mu-96Tests 96 Tests
EUR 677
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Ra-48Tests 48 Tests
EUR 511
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Ra-96Tests 96 Tests
EUR 709
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Hu-48Tests 48 Tests
EUR 500
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Hu-96Tests 96 Tests
EUR 692
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Mu-48Tests 48 Tests
EUR 511
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Mu-96Tests 96 Tests
EUR 709
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Ra-48Tests 48 Tests
EUR 534
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Ra-96Tests 96 Tests
EUR 742
Rabbit ADAM8 ELISA Kit
ERTA0737 96Tests
EUR 521
Polyclonal ADAM8 Antibody (N-term)
APR03901G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM8 (N-term). This antibody is tested and proven to work in the following applications:
ADAM8 Polyclonal Antibody, HRP Conjugated
A69792 100 ?g
EUR 628.55
Description: kits suitable for this type of research
ADAM8 Polyclonal Antibody, FITC Conjugated
A69793 100 ?g
EUR 628.55
Description: fast delivery possible
ADAM8 Polyclonal Antibody, Biotin Conjugated
A69794 100 ?g
EUR 628.55
Description: reagents widely cited
ADAM8 antibody
70R-9938 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ADAM8 antibody
ADAM8 Antibody
ABD10153 100 ug
EUR 438
ADAM8 Antibody
44547-100ul 100ul
EUR 252
ADAM8 Antibody
44547-50ul 50ul
EUR 187
ADAM8 Antibody
DF10153 200ul
EUR 304
Description: ADAM8 Antibody detects endogenous levels of total ADAM8.
ADAM8 Antibody
1-CSB-PA10259A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
ADAM8 Conjugated Antibody
C44547 100ul
EUR 397
anti- ADAM8 antibody
FNab00144 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ADAM metallopeptidase domain 8
  • Uniprot ID: P78325
  • Gene ID: 101
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience
Description: Antibody raised against ADAM8
Anti-ADAM8 antibody
PAab00144 100 ug
EUR 355
Anti-ADAM8 antibody
STJ111751 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ112521 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ117216 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ192019 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ADAM8
ADAM8/ Rat ADAM8 ELISA Kit
ELA-E0620r 96 Tests
EUR 886
Polyclonal Goat Anti-MS2 / ADAM8 / CD156 Antibody
APG00203G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MS2 / ADAM8 / CD156 . This antibody is tested and proven to work in the following applications:
ADAM8 siRNA
20-abx906740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADAM8 siRNA
20-abx906741
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADAM8 Antibody, HRP conjugated
1-CSB-PA10259B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ADAM8 Antibody, FITC conjugated
1-CSB-PA10259C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ADAM8 Antibody, Biotin conjugated
1-CSB-PA10259D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ADAM8 Blocking Peptide
33R-5019 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAM8 antibody, catalog no. 70R-9938
ADAM8 Blocking Peptide
DF10153-BP 1mg
EUR 195
ADAM8 cloning plasmid
CSB-CL001295HU-10ug 10ug
EUR 803
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2475
  • Sequence: ATGCGCGGCCTCGGGCTCTGGCTGCTGGGCGCGATGATGCTGCCTGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTGTTGCCGCGGCGTCTGCCAGGCCCCCGAGTCCGCCGAGCTCTGCCCTCCCACTTGGGCCTGCACCCAGAGAGGGTGAGCT
  • Show more
Description: A cloning plasmid for the ADAM8 gene.
Anti-MS2 / ADAM8 / CD156 antibody
STJ70155 100 µg
EUR 359
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human)
4-PAA620Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8)
Rabbit ADAM Metallopeptidase Domain 8 (ADAM8) ELISA Kit
abx363171-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC
4-PAA620Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Biotinylated
4-PAA620Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Cy3
4-PAA620Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), FITC
4-PAA620Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), HRP
4-PAA620Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), PE
4-PAA620Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse)
4-PAA620Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8)
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx124086
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx125491
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx147984
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx027773-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx027773-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx230144-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human ADAM8 ELISA Kit
EHA0737 96Tests
EUR 521
Human ADAM8 ELISA Kit
ELA-E0620h 96 Tests
EUR 824
Goat ADAM8 ELISA Kit
EGTA0737 96Tests
EUR 521
Canine ADAM8 ELISA Kit
ECA0737 96Tests
EUR 521
Chicken ADAM8 ELISA Kit
ECKA0737 96Tests
EUR 521
Bovine ADAM8 ELISA Kit
EBA0737 96Tests
EUR 521
Anserini ADAM8 ELISA Kit
EAA0737 96Tests
EUR 521
Human ADAM8 ELISA KIT
ELI-02207h 96 Tests
EUR 824
Mouse Adam8 ELISA KIT
ELI-02208m 96 Tests
EUR 865
ADAM8 ELISA KIT|Human
EF000674 96 Tests
EUR 689
Rat ADAM8 ELISA Kit
ERA0737 96Tests
EUR 521
Sheep ADAM8 ELISA Kit
ESA0737 96Tests
EUR 521
Porcine ADAM8 ELISA Kit
EPA0737 96Tests
EUR 521
Mouse ADAM8 ELISA Kit
EMA0737 96Tests
EUR 521
Monkey ADAM8 ELISA Kit
EMKA0737 96Tests
EUR 521
Human ADAM8 shRNA Plasmid
20-abx950065
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADAM8 shRNA Plasmid
20-abx969038
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ADAM8 Recombinant Protein (Human)
RP036442 100 ug Ask for price
ADAM8 Recombinant Protein (Mouse)
RP114275 100 ug Ask for price
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC-Cy7
4-PAA620Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC
4-PAA620Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA620Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA620Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), FITC
4-PAA620Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), HRP
4-PAA620Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), PE
4-PAA620Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx128719
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx129645
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx171034
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx175200
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx175201
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx338630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human ADAM8
EK5261 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAM8 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ADAM8 PicoKine ELISA Kit
EK0650 96 wells
EUR 425
Description: For quantitative detection of human ADAM8 in cell culture supernates and serum.
Guinea Pig ADAM8 ELISA Kit
EGA0737 96Tests
EUR 521
Adam8 ORF Vector (Mouse) (pORF)
ORF038093 1.0 ug DNA
EUR 506
ADAM8 ORF Vector (Human) (pORF)
ORF012148 1.0 ug DNA
EUR 354
Recombinant human ADAM8/CD156a Protein
RP01201 10 μg
EUR 230
ADAM8 ELISA Kit (Human) (OKAN05576)
OKAN05576 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.37 pg/mL
ADAM8 ELISA Kit (Human) (OKCD06587)
OKCD06587 96 Wells
EUR 753
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.52pg/mL
ADAM8 ELISA Kit (Mouse) (OKCD02341)
OKCD02341 96 Wells
EUR 779
Description: Description of target: Possible involvement in extravasation of leukocytes. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.3 pg/mL
ADAM8 ELISA Kit (Human) (OKBB00765)
OKBB00765 96 Wells
EUR 505
Description: Description of target: A Disintegrin and metalloproteinase domain-containing protein 8 is an enzyme that in humans is encoded by the ADAM8 gene. ADAM8 is localized to chromosome 10q26.3. This gene encodes a member of the ADAM (a disintegrin and metalloproteinase domain) family. Members of the ADAM family, such as ADAM8, are cell surface proteases involved in remodeling of extracellular matrix, cell migration, and processing of membrane-bound signaling molecules. They are characterized by disintegrin and metalloprotease domains that confer adhesive properties and proteolytic activities, respectively. And the protein encoded by this gene may be involved in cell adhesion duringneurodegeneration.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA620Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (HRP)
20-abx335370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (FITC)
20-abx335371
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (Biotin)
20-abx335372
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADAM8 sgRNA CRISPR Lentivector set (Human)
K0041601 3 x 1.0 ug
EUR 339
Adam8 sgRNA CRISPR Lentivector set (Mouse)
K3355701 3 x 1.0 ug
EUR 339
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0041602 1.0 ug DNA
EUR 154
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0041603 1.0 ug DNA
EUR 154
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0041604 1.0 ug DNA
EUR 154
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3355702 1.0 ug DNA
EUR 154
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3355703 1.0 ug DNA
EUR 154
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3355704 1.0 ug DNA
EUR 154
ADAM8 Protein Vector (Human) (pPB-C-His)
PV048589 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPB-N-His)
PV048590 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPM-C-HA)
PV048591 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPM-C-His)
PV048592 500 ng
EUR 481
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8)
4-RPA620Hu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78325
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human A Disintegrin And Metalloprotease 8 expressed in: E.coli
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8)
4-RPA620Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q05910
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.4kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse A Disintegrin And Metalloprotease 8 expressed in: E.coli
ADAM8 Protein Vector (Human) (pPB-His-MBP)
PV319822 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPB-His-GST)
PV319823 500 ng
EUR 481
ADAM8 Protein Vector (Mouse) (pPB-C-His)
PV152370 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPB-N-His)
PV152371 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPM-C-HA)
PV152372 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPM-C-His)
PV152373 500 ng
EUR 1065
Adam8 3'UTR Luciferase Stable Cell Line
TU200269 1.0 ml Ask for price
Adam8 3'UTR GFP Stable Cell Line
TU151382 1.0 ml Ask for price
ADAM8 3'UTR Luciferase Stable Cell Line
TU000295 1.0 ml
EUR 2333
Adam8 3'UTR Luciferase Stable Cell Line
TU101382 1.0 ml Ask for price
ADAM8 3'UTR GFP Stable Cell Line
TU050295 1.0 ml
EUR 2333
Adam8 3'UTR GFP Stable Cell Line
TU250269 1.0 ml Ask for price
Recombinant Mouse ADAM8 Protein (aa 17-658)
VAng-2875Lsx-1mg 1 mg
EUR 6759
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 17-658)
VAng-2875Lsx-500g 500 µg
EUR 4009
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-1mg 1 mg
EUR 3748
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-200g 200 µg
EUR 2291
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-500g 500 µg
EUR 2525
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-1mg 1 mg
EUR 4119
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-200g 200 µg
EUR 1466
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-500g 500 µg
EUR 2785
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
ADAM8 ELISA Kit (Human) : 96 Wells (OKEH02629)
OKEH02629 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ADAM8 Rabbit Polyclonal Antibody