ADAM8 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ADAM8 Polyclonal Antibody
ABP57712-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
ABP57712-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
ABP57712-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein
ADAM8 Polyclonal Antibody
ES10861-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADAM8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ADAM8 Polyclonal Antibody
ES10861-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADAM8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ADAM8 Rabbit pAb
A10497-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A10497-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A10497-20ul 20 ul
EUR 183
ADAM8 Rabbit pAb
A10497-50ul 50 ul
EUR 223
ADAM8 Rabbit pAb
A9578-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A9578-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A9578-20ul 20 ul Ask for price
ADAM8 Rabbit pAb
A9578-50ul 50 ul Ask for price
ADAM8 Rabbit pAb
A15022-100ul 100 ul
EUR 308
ADAM8 Rabbit pAb
A15022-200ul 200 ul
EUR 459
ADAM8 Rabbit pAb
A15022-20ul 20 ul
EUR 183
ADAM8 Rabbit pAb
A15022-50ul 50 ul
EUR 223
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Hu-48T 48T
EUR 479
  • Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Hu-96T 96T
EUR 621
  • Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Mu-48T 48T
EUR 489
  • Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Mu-96T 96T
EUR 635
  • Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Ra-48T 48T
EUR 508
  • Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
DLR-ADAM8-Ra-96T 96T
EUR 661
  • Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Hu-48Tests 48 Tests
EUR 478
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Hu-96Tests 96 Tests
EUR 662
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Mu-48Tests 48 Tests
EUR 489
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Mu-96Tests 96 Tests
EUR 677
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Ra-48Tests 48 Tests
EUR 511
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RD-ADAM8-Ra-96Tests 96 Tests
EUR 709
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Hu-48Tests 48 Tests
EUR 500
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Hu-96Tests 96 Tests
EUR 692
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Mu-48Tests 48 Tests
EUR 511
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Mu-96Tests 96 Tests
EUR 709
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Ra-48Tests 48 Tests
EUR 534
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit
RDR-ADAM8-Ra-96Tests 96 Tests
EUR 742
Rabbit ADAM8 ELISA Kit
ERTA0737 96Tests
EUR 521
Polyclonal ADAM8 Antibody (N-term)
APR03901G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM8 (N-term). This antibody is tested and proven to work in the following applications:
ADAM8 Polyclonal Antibody, HRP Conjugated
A69792 100 ?g
EUR 628.55
Description: kits suitable for this type of research
ADAM8 Polyclonal Antibody, FITC Conjugated
A69793 100 ?g
EUR 628.55
Description: fast delivery possible
ADAM8 Polyclonal Antibody, Biotin Conjugated
A69794 100 ?g
EUR 628.55
Description: reagents widely cited
ADAM8 Antibody
44547-100ul 100ul
EUR 252
ADAM8 Antibody
44547-50ul 50ul
EUR 187
ADAM8 Antibody
1-CSB-PA10259A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
ADAM8 Antibody
DF10153 200ul
EUR 304
Description: ADAM8 Antibody detects endogenous levels of total ADAM8.
ADAM8 antibody
70R-9938 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ADAM8 antibody
ADAM8 Antibody
ABD10153 100 ug
EUR 438
ADAM8 Conjugated Antibody
C44547 100ul
EUR 397
anti- ADAM8 antibody
FNab00144 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ADAM metallopeptidase domain 8
  • Uniprot ID: P78325
  • Gene ID: 101
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience
Description: Antibody raised against ADAM8
Anti-ADAM8 antibody
PAab00144 100 ug
EUR 355
Anti-ADAM8 antibody
STJ111751 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ112521 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ117216 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.
Anti-ADAM8 antibody
STJ192019 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ADAM8
ADAM8/ Rat ADAM8 ELISA Kit
ELA-E0620r 96 Tests
EUR 886
Polyclonal Goat Anti-MS2 / ADAM8 / CD156 Antibody
APG00203G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MS2 / ADAM8 / CD156 . This antibody is tested and proven to work in the following applications:
ADAM8 siRNA
20-abx906740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADAM8 siRNA
20-abx906741
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ADAM8 Antibody, HRP conjugated
1-CSB-PA10259B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ADAM8 Antibody, FITC conjugated
1-CSB-PA10259C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ADAM8 Antibody, Biotin conjugated
1-CSB-PA10259D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ADAM8 Blocking Peptide
33R-5019 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAM8 antibody, catalog no. 70R-9938
ADAM8 Blocking Peptide
DF10153-BP 1mg
EUR 195
ADAM8 cloning plasmid
CSB-CL001295HU-10ug 10ug
EUR 803
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2475
  • Sequence: ATGCGCGGCCTCGGGCTCTGGCTGCTGGGCGCGATGATGCTGCCTGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTGTTGCCGCGGCGTCTGCCAGGCCCCCGAGTCCGCCGAGCTCTGCCCTCCCACTTGGGCCTGCACCCAGAGAGGGTGAGCT
  • Show more
Description: A cloning plasmid for the ADAM8 gene.
Anti-MS2 / ADAM8 / CD156 antibody
STJ70155 100 µg
EUR 359
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human)
4-PAA620Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8)
Rabbit ADAM Metallopeptidase Domain 8 (ADAM8) ELISA Kit
abx363171-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC
4-PAA620Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Biotinylated
4-PAA620Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Cy3
4-PAA620Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), FITC
4-PAA620Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), HRP
4-PAA620Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), PE
4-PAA620Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse)
4-PAA620Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8)
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx027773-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx027773-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx124086
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx125491
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
20-abx147984
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody
abx230144-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human ADAM8 ELISA Kit
EHA0737 96Tests
EUR 521
Human ADAM8 ELISA Kit
ELA-E0620h 96 Tests
EUR 824
Goat ADAM8 ELISA Kit
EGTA0737 96Tests
EUR 521
Bovine ADAM8 ELISA Kit
EBA0737 96Tests
EUR 521
Canine ADAM8 ELISA Kit
ECA0737 96Tests
EUR 521
Chicken ADAM8 ELISA Kit
ECKA0737 96Tests
EUR 521
Anserini ADAM8 ELISA Kit
EAA0737 96Tests
EUR 521
Human ADAM8 ELISA KIT
ELI-02207h 96 Tests
EUR 824
Mouse Adam8 ELISA KIT
ELI-02208m 96 Tests
EUR 865
ADAM8 ELISA KIT|Human
EF000674 96 Tests
EUR 689
Human ADAM8 shRNA Plasmid
20-abx950065
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADAM8 shRNA Plasmid
20-abx969038
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADAM8 ELISA Kit
EMA0737 96Tests
EUR 521
Rat ADAM8 ELISA Kit
ERA0737 96Tests
EUR 521
Sheep ADAM8 ELISA Kit
ESA0737 96Tests
EUR 521
Monkey ADAM8 ELISA Kit
EMKA0737 96Tests
EUR 521
Porcine ADAM8 ELISA Kit
EPA0737 96Tests
EUR 521
ADAM8 Recombinant Protein (Human)
RP036442 100 ug Ask for price
ADAM8 Recombinant Protein (Mouse)
RP114275 100 ug Ask for price
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC-Cy7
4-PAA620Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Ser371~Glu587)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC
4-PAA620Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA620Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA620Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), FITC
4-PAA620Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), HRP
4-PAA620Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), PE
4-PAA620Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx128719
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx129645
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx175200
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx175201
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx171034
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody
20-abx338630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human ADAM8
EK5261 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAM8 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ADAM8 PicoKine ELISA Kit
EK0650 96 wells
EUR 425
Description: For quantitative detection of human ADAM8 in cell culture supernates and serum.
Guinea Pig ADAM8 ELISA Kit
EGA0737 96Tests
EUR 521
ADAM8 ORF Vector (Human) (pORF)
ORF012148 1.0 ug DNA
EUR 354
Adam8 ORF Vector (Mouse) (pORF)
ORF038093 1.0 ug DNA
EUR 506
Recombinant human ADAM8/CD156a Protein
RP01201 10 μg
EUR 230
ADAM8 ELISA Kit (Human) (OKAN05576)
OKAN05576 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.37 pg/mL
ADAM8 ELISA Kit (Mouse) (OKCD02341)
OKCD02341 96 Wells
EUR 779
Description: Description of target: Possible involvement in extravasation of leukocytes. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.3 pg/mL
ADAM8 ELISA Kit (Human) (OKBB00765)
OKBB00765 96 Wells
EUR 505
Description: Description of target: A Disintegrin and metalloproteinase domain-containing protein 8 is an enzyme that in humans is encoded by the ADAM8 gene. ADAM8 is localized to chromosome 10q26.3. This gene encodes a member of the ADAM (a disintegrin and metalloproteinase domain) family. Members of the ADAM family, such as ADAM8, are cell surface proteases involved in remodeling of extracellular matrix, cell migration, and processing of membrane-bound signaling molecules. They are characterized by disintegrin and metalloprotease domains that confer adhesive properties and proteolytic activities, respectively. And the protein encoded by this gene may be involved in cell adhesion duringneurodegeneration.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
ADAM8 ELISA Kit (Human) (OKCD06587)
OKCD06587 96 Wells
EUR 753
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.52pg/mL
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA620Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM8 (Glu145~Cys493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (HRP)
20-abx335370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (FITC)
20-abx335371
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (Biotin)
20-abx335372
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Adam8 sgRNA CRISPR Lentivector set (Mouse)
K3355701 3 x 1.0 ug
EUR 339
ADAM8 sgRNA CRISPR Lentivector set (Human)
K0041601 3 x 1.0 ug
EUR 339
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3355702 1.0 ug DNA
EUR 154
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3355703 1.0 ug DNA
EUR 154
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3355704 1.0 ug DNA
EUR 154
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0041602 1.0 ug DNA
EUR 154
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0041603 1.0 ug DNA
EUR 154
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0041604 1.0 ug DNA
EUR 154
ADAM8 Protein Vector (Mouse) (pPB-C-His)
PV152370 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPB-N-His)
PV152371 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPM-C-HA)
PV152372 500 ng
EUR 1065
ADAM8 Protein Vector (Mouse) (pPM-C-His)
PV152373 500 ng
EUR 1065
ADAM8 Protein Vector (Human) (pPB-His-MBP)
PV319822 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPB-His-GST)
PV319823 500 ng
EUR 481
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8)
4-RPA620Hu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78325
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human A Disintegrin And Metalloprotease 8 expressed in: E.coli
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8)
4-RPA620Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q05910
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.4kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse A Disintegrin And Metalloprotease 8 expressed in: E.coli
ADAM8 Protein Vector (Human) (pPB-C-His)
PV048589 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPB-N-His)
PV048590 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPM-C-HA)
PV048591 500 ng
EUR 481
ADAM8 Protein Vector (Human) (pPM-C-His)
PV048592 500 ng
EUR 481
Adam8 3'UTR Luciferase Stable Cell Line
TU101382 1.0 ml Ask for price
Adam8 3'UTR GFP Stable Cell Line
TU151382 1.0 ml Ask for price
Adam8 3'UTR Luciferase Stable Cell Line
TU200269 1.0 ml Ask for price
Adam8 3'UTR GFP Stable Cell Line
TU250269 1.0 ml Ask for price
ADAM8 3'UTR GFP Stable Cell Line
TU050295 1.0 ml
EUR 2333
ADAM8 3'UTR Luciferase Stable Cell Line
TU000295 1.0 ml
EUR 2333
Recombinant Mouse ADAM8 Protein (aa 17-658)
VAng-2875Lsx-1mg 1 mg
EUR 6759
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 17-658)
VAng-2875Lsx-500g 500 µg
EUR 4009
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-1mg 1 mg
EUR 3748
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-200g 200 µg
EUR 2291
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Human ADAM8 Protein (aa 196-403)
VAng-2876Lsx-500g 500 µg
EUR 2525
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-1mg 1 mg
EUR 4119
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-200g 200 µg
EUR 1466
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
Recombinant Mouse ADAM8 Protein (aa 145-493)
VAng-2877Lsx-500g 500 µg
EUR 2785
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910)
ADAM8 ELISA Kit (Human) : 96 Wells (OKEH02629)
OKEH02629 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

ADAM8 Rabbit Polyclonal Antibody