ADAM8 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ADAM8 Polyclonal Antibody |
ABP57712-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
ABP57712-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
ABP57712-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
ES10861-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ADAM8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ADAM8 Polyclonal Antibody |
ES10861-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ADAM8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ADAM8 Rabbit pAb |
A10497-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A10497-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A10497-20ul |
Abclonal |
20 ul |
EUR 183 |
ADAM8 Rabbit pAb |
A10497-50ul |
Abclonal |
50 ul |
EUR 223 |
ADAM8 Rabbit pAb |
A9578-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A9578-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A9578-20ul |
Abclonal |
20 ul |
Ask for price |
ADAM8 Rabbit pAb |
A9578-50ul |
Abclonal |
50 ul |
Ask for price |
ADAM8 Rabbit pAb |
A15022-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A15022-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A15022-20ul |
Abclonal |
20 ul |
EUR 183 |
ADAM8 Rabbit pAb |
A15022-50ul |
Abclonal |
50 ul |
EUR 223 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit ADAM8 ELISA Kit |
ERTA0737 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal ADAM8 Antibody (N-term) |
APR03901G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM8 (N-term). This antibody is tested and proven to work in the following applications: |
ADAM8 Polyclonal Antibody, HRP Conjugated |
A69792 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
ADAM8 Polyclonal Antibody, FITC Conjugated |
A69793 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
ADAM8 Polyclonal Antibody, Biotin Conjugated |
A69794 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
ADAM8 Antibody |
44547-100ul |
SAB |
100ul |
EUR 252 |
ADAM8 Antibody |
44547-50ul |
SAB |
50ul |
EUR 187 |
ADAM8 Antibody |
1-CSB-PA10259A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200 |
ADAM8 Antibody |
DF10153 |
Affbiotech |
200ul |
EUR 304 |
Description: ADAM8 Antibody detects endogenous levels of total ADAM8. |
ADAM8 antibody |
70R-9938 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ADAM8 antibody |
ADAM8 Conjugated Antibody |
C44547 |
SAB |
100ul |
EUR 397 |
anti- ADAM8 antibody |
FNab00144 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: ADAM metallopeptidase domain 8
- Uniprot ID: P78325
- Gene ID: 101
- Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience
|
Description: Antibody raised against ADAM8 |
Anti-ADAM8 antibody |
STJ111751 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ112521 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ117216 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ192019 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ADAM8 |
Polyclonal Goat Anti-MS2 / ADAM8 / CD156 Antibody |
APG00203G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MS2 / ADAM8 / CD156 . This antibody is tested and proven to work in the following applications: |
ADAM8 siRNA |
20-abx906740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM8 siRNA |
20-abx906741 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM8 Antibody, HRP conjugated |
1-CSB-PA10259B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ADAM8 Antibody, FITC conjugated |
1-CSB-PA10259C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ADAM8 Antibody, Biotin conjugated |
1-CSB-PA10259D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ADAM8 Blocking Peptide |
33R-5019 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAM8 antibody, catalog no. 70R-9938 |
ADAM8 Blocking Peptide |
DF10153-BP |
Affbiotech |
1mg |
EUR 195 |
ADAM8 cloning plasmid |
CSB-CL001295HU-10ug |
Cusabio |
10ug |
EUR 803 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2475
- Sequence: ATGCGCGGCCTCGGGCTCTGGCTGCTGGGCGCGATGATGCTGCCTGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTGTTGCCGCGGCGTCTGCCAGGCCCCCGAGTCCGCCGAGCTCTGCCCTCCCACTTGGGCCTGCACCCAGAGAGGGTGAGCT
- Show more
|
Description: A cloning plasmid for the ADAM8 gene. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human) |
4-PAA620Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8) |
Rabbit ADAM Metallopeptidase Domain 8 (ADAM8) ELISA Kit |
abx363171-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC |
4-PAA620Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Biotinylated |
4-PAA620Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Cy3 |
4-PAA620Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), FITC |
4-PAA620Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), HRP |
4-PAA620Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), PE |
4-PAA620Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse) |
4-PAA620Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8) |
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx027773-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx027773-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx124086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx125491 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx147984 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx230144-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human ADAM8 ELISA Kit |
EHA0737 |
Abclonal |
96Tests |
EUR 521 |
Goat ADAM8 ELISA Kit |
EGTA0737 |
Abclonal |
96Tests |
EUR 521 |
Bovine ADAM8 ELISA Kit |
EBA0737 |
Abclonal |
96Tests |
EUR 521 |
Canine ADAM8 ELISA Kit |
ECA0737 |
Abclonal |
96Tests |
EUR 521 |
Chicken ADAM8 ELISA Kit |
ECKA0737 |
Abclonal |
96Tests |
EUR 521 |
Anserini ADAM8 ELISA Kit |
EAA0737 |
Abclonal |
96Tests |
EUR 521 |
Human ADAM8 shRNA Plasmid |
20-abx950065 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADAM8 shRNA Plasmid |
20-abx969038 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADAM8 ELISA Kit |
EMA0737 |
Abclonal |
96Tests |
EUR 521 |
Rat ADAM8 ELISA Kit |
ERA0737 |
Abclonal |
96Tests |
EUR 521 |
Sheep ADAM8 ELISA Kit |
ESA0737 |
Abclonal |
96Tests |
EUR 521 |
Monkey ADAM8 ELISA Kit |
EMKA0737 |
Abclonal |
96Tests |
EUR 521 |
Porcine ADAM8 ELISA Kit |
EPA0737 |
Abclonal |
96Tests |
EUR 521 |
ADAM8 Recombinant Protein (Human) |
RP036442 |
ABM |
100 ug |
Ask for price |
ADAM8 Recombinant Protein (Mouse) |
RP114275 |
ABM |
100 ug |
Ask for price |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA620Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC |
4-PAA620Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA620Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA620Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA620Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA620Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), PE |
4-PAA620Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE. |
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx128719 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx129645 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx175200 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx175201 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx171034 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx338630 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human ADAM8 |
EK5261 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAM8 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human ADAM8 PicoKine ELISA Kit |
EK0650 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human ADAM8 in cell culture supernates and serum. |
Guinea Pig ADAM8 ELISA Kit |
EGA0737 |
Abclonal |
96Tests |
EUR 521 |
ADAM8 ORF Vector (Human) (pORF) |
ORF012148 |
ABM |
1.0 ug DNA |
EUR 354 |
Adam8 ORF Vector (Mouse) (pORF) |
ORF038093 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant human ADAM8/CD156a Protein |
RP01201 |
Abclonal |
10 μg |
EUR 230 |
ADAM8 ELISA Kit (Human) (OKAN05576) |
OKAN05576 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.37 pg/mL |
ADAM8 ELISA Kit (Mouse) (OKCD02341) |
OKCD02341 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Possible involvement in extravasation of leukocytes. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.3 pg/mL |
ADAM8 ELISA Kit (Human) (OKBB00765) |
OKBB00765 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: A Disintegrin and metalloproteinase domain-containing protein 8 is an enzyme that in humans is encoded by the ADAM8 gene. ADAM8 is localized to chromosome 10q26.3. This gene encodes a member of the ADAM (a disintegrin and metalloproteinase domain) family. Members of the ADAM family, such as ADAM8, are cell surface proteases involved in remodeling of extracellular matrix, cell migration, and processing of membrane-bound signaling molecules. They are characterized by disintegrin and metalloprotease domains that confer adhesive properties and proteolytic activities, respectively. And the protein encoded by this gene may be involved in cell adhesion duringneurodegeneration.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
ADAM8 ELISA Kit (Human) (OKCD06587) |
OKCD06587 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.52pg/mL |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA620Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7. |
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (HRP) |
20-abx335370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (FITC) |
20-abx335371 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody (Biotin) |
20-abx335372 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Adam8 sgRNA CRISPR Lentivector set (Mouse) |
K3355701 |
ABM |
3 x 1.0 ug |
EUR 339 |
ADAM8 sgRNA CRISPR Lentivector set (Human) |
K0041601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3355702 |
ABM |
1.0 ug DNA |
EUR 154 |
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3355703 |
ABM |
1.0 ug DNA |
EUR 154 |
Adam8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3355704 |
ABM |
1.0 ug DNA |
EUR 154 |
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0041602 |
ABM |
1.0 ug DNA |
EUR 154 |
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0041603 |
ABM |
1.0 ug DNA |
EUR 154 |
ADAM8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0041604 |
ABM |
1.0 ug DNA |
EUR 154 |
ADAM8 Protein Vector (Mouse) (pPB-C-His) |
PV152370 |
ABM |
500 ng |
EUR 1065 |
ADAM8 Protein Vector (Mouse) (pPB-N-His) |
PV152371 |
ABM |
500 ng |
EUR 1065 |
ADAM8 Protein Vector (Mouse) (pPM-C-HA) |
PV152372 |
ABM |
500 ng |
EUR 1065 |
ADAM8 Protein Vector (Mouse) (pPM-C-His) |
PV152373 |
ABM |
500 ng |
EUR 1065 |
ADAM8 Protein Vector (Human) (pPB-His-MBP) |
PV319822 |
ABM |
500 ng |
EUR 481 |
ADAM8 Protein Vector (Human) (pPB-His-GST) |
PV319823 |
ABM |
500 ng |
EUR 481 |
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8) |
4-RPA620Hu01 |
Cloud-Clone |
-
EUR 528.29
-
EUR 244.00
-
EUR 1706.08
-
EUR 635.36
-
EUR 1170.72
-
EUR 416.00
-
EUR 4115.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78325
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.2kDa
- Isoelectric Point: 5.2
|
Description: Recombinant Human A Disintegrin And Metalloprotease 8 expressed in: E.coli |
Recombinant A Disintegrin And Metalloprotease 8 (ADAM8) |
4-RPA620Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q05910
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.4kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Mouse A Disintegrin And Metalloprotease 8 expressed in: E.coli |
ADAM8 Protein Vector (Human) (pPB-C-His) |
PV048589 |
ABM |
500 ng |
EUR 481 |
ADAM8 Protein Vector (Human) (pPB-N-His) |
PV048590 |
ABM |
500 ng |
EUR 481 |
ADAM8 Protein Vector (Human) (pPM-C-HA) |
PV048591 |
ABM |
500 ng |
EUR 481 |
ADAM8 Protein Vector (Human) (pPM-C-His) |
PV048592 |
ABM |
500 ng |
EUR 481 |
Adam8 3'UTR Luciferase Stable Cell Line |
TU101382 |
ABM |
1.0 ml |
Ask for price |
Adam8 3'UTR GFP Stable Cell Line |
TU151382 |
ABM |
1.0 ml |
Ask for price |
Adam8 3'UTR Luciferase Stable Cell Line |
TU200269 |
ABM |
1.0 ml |
Ask for price |
Adam8 3'UTR GFP Stable Cell Line |
TU250269 |
ABM |
1.0 ml |
Ask for price |
ADAM8 3'UTR GFP Stable Cell Line |
TU050295 |
ABM |
1.0 ml |
EUR 2333 |
ADAM8 3'UTR Luciferase Stable Cell Line |
TU000295 |
ABM |
1.0 ml |
EUR 2333 |
Recombinant Mouse ADAM8 Protein (aa 17-658) |
VAng-2875Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 6759 |
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910) |
Recombinant Mouse ADAM8 Protein (aa 17-658) |
VAng-2875Lsx-500g |
Creative Biolabs |
500 µg |
EUR 4009 |
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910) |
Recombinant Human ADAM8 Protein (aa 196-403) |
VAng-2876Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 3748 |
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325) |
Recombinant Human ADAM8 Protein (aa 196-403) |
VAng-2876Lsx-200g |
Creative Biolabs |
200 µg |
EUR 2291 |
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325) |
Recombinant Human ADAM8 Protein (aa 196-403) |
VAng-2876Lsx-500g |
Creative Biolabs |
500 µg |
EUR 2525 |
Description: Recombinant Human ADAM8 is expressed in E. coli. (Uniprot ID: P78325) |
Recombinant Mouse ADAM8 Protein (aa 145-493) |
VAng-2877Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4119 |
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910) |
Recombinant Mouse ADAM8 Protein (aa 145-493) |
VAng-2877Lsx-200g |
Creative Biolabs |
200 µg |
EUR 1466 |
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910) |
Recombinant Mouse ADAM8 Protein (aa 145-493) |
VAng-2877Lsx-500g |
Creative Biolabs |
500 µg |
EUR 2785 |
Description: Recombinant Mouse ADAM8 is expressed in E. coli. (Uniprot ID: Q05910) |
ADAM8 ELISA Kit (Human) : 96 Wells (OKEH02629) |
OKEH02629 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
ADAM8 Rabbit Polyclonal Antibody