APOA2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

APOA2 Polyclonal Antibody

ABP57790-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein

APOA2 Polyclonal Antibody

ABP57790-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein

APOA2 Polyclonal Antibody

ABP57790-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein

Human Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Hu-48T 48T
EUR 479
  • Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Hu-96T 96T
EUR 621
  • Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Mu-48T 48T
EUR 489
  • Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Mu-96T 96T
EUR 635
  • Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-p-48T 48T
EUR 547
  • Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-p-96T 96T
EUR 715
  • Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Ra-48T 48T
EUR 508
  • Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Ra-96T 96T
EUR 661
  • Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Hu-48Tests 48 Tests
EUR 478

Human Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Hu-96Tests 96 Tests
EUR 662

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Mu-48Tests 48 Tests
EUR 489

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Mu-96Tests 96 Tests
EUR 677

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-p-48Tests 48 Tests
EUR 555

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-p-96Tests 96 Tests
EUR 771

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Ra-48Tests 48 Tests
EUR 511

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Ra-96Tests 96 Tests
EUR 709

Human Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Hu-48Tests 48 Tests
EUR 500

Human Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Hu-96Tests 96 Tests
EUR 692

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Mu-48Tests 48 Tests
EUR 511

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Mu-96Tests 96 Tests
EUR 709

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-p-48Tests 48 Tests
EUR 580

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-p-96Tests 96 Tests
EUR 807

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Ra-48Tests 48 Tests
EUR 534

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Ra-96Tests 96 Tests
EUR 742

APOA2 Rabbit pAb

A1711-100ul 100 ul
EUR 308

APOA2 Rabbit pAb

A1711-200ul 200 ul
EUR 459

APOA2 Rabbit pAb

A1711-20ul 20 ul Ask for price

APOA2 Rabbit pAb

A1711-50ul 50 ul Ask for price

APOA2 Rabbit pAb

A14690-100ul 100 ul
EUR 308

APOA2 Rabbit pAb

A14690-200ul 200 ul
EUR 459

APOA2 Rabbit pAb

A14690-20ul 20 ul
EUR 183

APOA2 Rabbit pAb

A14690-50ul 50 ul
EUR 223

Rabbit APOA2 ELISA Kit

ERTA0517 96Tests
EUR 521

APOA2 Antibody

ABD7905 100 ug
EUR 438

APOA2 Antibody

ABD7912 100 ug
EUR 438

APOA2 Antibody

45172-100ul 100ul
EUR 252

APOA2 Antibody

45172-50ul 50ul
EUR 187

APOA2 Antibody

DF7905 200ul
EUR 304
Description: APOA2 Antibody detects endogenous levels of total APOA2.

APOA2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity purified
Description: A polyclonal antibody against APOA2. Recognizes APOA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01944G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01945G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01946G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2)

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig)

  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2)

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2)

APOA2 Conjugated Antibody

C45172 100ul
EUR 397

Anti-APOA2 antibody

STJ111107 100 µl
EUR 277
Description: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.

Anti-APOA2 antibody

STJ118047 100 µl
EUR 277

Anti-APOA2 antibody

STJ192001 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APOA2

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC

  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Biotinylated

  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Cy3

  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), FITC

  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), HRP

  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), PE

  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Rabbit Apolipoprotein A2 (APOA2) ELISA Kit

abx363450-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOA2 Protein

  • EUR 328.00
  • EUR 1247.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ApoA2 protein

30-1048 100 ug
EUR 382
Description: Purified native Human ApoA2 protein

Apolipoprotein A2 (APOA2) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 1372.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC-Cy7

  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

Apolipoprotein A-II (APOA2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

abx034964-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

abx034964-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Apolipoprotein A2 (APOA2) Antibody Pair

  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (FITC)

  • EUR 509.00
  • EUR 258.00
  • EUR 1511.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (FITC)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1400.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A II (APOA2) Antibody

abx230507-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

APOA2 Blocking Peptide

DF7905-BP 1mg
EUR 195

APOA2 cloning plasmid

CSB-CL001915HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 303
  • Sequence: atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggc
  • Show more
Description: A cloning plasmid for the APOA2 gene.

Rat APOA2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHA0517 96Tests
EUR 521


EGTA0517 96Tests
EUR 521

Canine APOA2 ELISA Kit

ECA0517 96Tests
EUR 521

Chicken APOA2 ELISA Kit

ECKA0517 96Tests
EUR 521

Bovine APOA2 ELISA Kit

EBA0517 96Tests
EUR 521

Anserini APOA2 ELISA Kit

EAA0517 96Tests
EUR 521


ELA-E8884h 96 Tests
EUR 824


EF001204 96 Tests
EUR 689


ERA0517 96Tests
EUR 521


ESA0517 96Tests
EUR 521

Porcine APOA2 ELISA Kit

EPA0517 96Tests
EUR 521


EMA0517 96Tests
EUR 521

Monkey APOA2 ELISA Kit

EMKA0517 96Tests
EUR 521

Human APOA2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse APOA2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Apolipoprotein A2 (APOA2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02652
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Apolipoprotein A2 expressed in: E.coli

Recombinant Apolipoprotein A2 (APOA2)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1S1A9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.1kDa
  • Isoelectric Point: 6.2
Description: Recombinant Pig Apolipoprotein A2 expressed in: E.coli

Recombinant Apolipoprotein A2 (APOA2)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04638
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.9kDa
  • Isoelectric Point: 5.9
Description: Recombinant Rat Apolipoprotein A2 expressed in: E.coli

APOA2 Recombinant Protein (Human)

RP001552 100 ug Ask for price

APOA2 Recombinant Protein (Rat)

RP190532 100 ug Ask for price

APOA2 Recombinant Protein (Mouse)

RP116420 100 ug Ask for price

Mouse Apolipoprotein A2 (APOA2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Apolipoprotein A2 (APOA2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea Pig APOA2 ELISA Kit

EGA0517 96Tests
EUR 521

Human Apolipoprotein A2 (APOA2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Pig Apolipoprotein A2 (APOA2) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Apolipoprotein A2 (APOA2) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

APOA2 ORF Vector (Human) (pORF)

ORF000518 1.0 ug DNA
EUR 95

APOA2 Apolipoprotein A-II Human

PROTP02647-1 Regular: 100ug
EUR 317
Description: APOA2 Human isolated from Human HDL is a single, glycosylated, polypeptide chain having a molecular mass of 17.38kDa. APOA2 is purified using delipidation and gel permeation chromatographic technique.

Apoa2 ORF Vector (Mouse) (pORF)

ORF038808 1.0 ug DNA
EUR 506

Apoa2 ORF Vector (Rat) (pORF)

ORF063512 1.0 ug DNA
EUR 506

APOA2 ELISA Kit (Human) (OKAN04533)

OKAN04533 96 Wells
EUR 792
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.69 ng/mL

APOA2 ELISA Kit (Mouse) (OKAN06281)

OKAN06281 96 Wells
EUR 792
Description: Description of target: This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL

APOA2 ELISA Kit (Pig) (OKCD04399)

OKCD04399 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.8 ug/mL

APOA2 ELISA Kit (Human) (OKCD06573)

OKCD06573 96 Wells
EUR 753
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.69ng/mL

APOA2 ELISA Kit (Rat) (OKCD06574)

OKCD06574 96 Wells
EUR 818
Description: Description of target: may play a role in lipid metabolism and transport.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.57ng/mL

APOA2 ELISA Kit (Mouse) (OKCD02376)

OKCD02376 96 Wells
EUR 779
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids, and affect the HDL metabolism. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL

APOA2 ELISA Kit (Human) (OKEH01868)

OKEH01868 96 Wells
EUR 544
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.151 ng/mL

APOA2 ELISA Kit (Rat) (OKEH01869)

OKEH01869 96 Wells
EUR 831
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids and affect the HDL metabolism.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.00402 ug/mL

APOA2 ELISA Kit (Mouse) (OKCA02159)

OKCA02159 96 Wells
EUR 833
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids, and affect the HDL metabolism. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL

APOA2 ELISA Kit (Dog) (OKEH08707)

OKEH08707 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

APOA2 ELISA Kit (Pig) (OKWB00316)

OKWB00316 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 2.8 ng/mL

Cow Apolipoprotein A2 (APOA2) ELISA Kit

abx520836-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Apolipoprotein A2 (APOA2) ELISA Kit

abx520837-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

abx520839-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Monkey Apolipoprotein A2 (APOA2) ELISA Kit

abx360157-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

abx575769-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

abx575871-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Apolipoprotein A2 (APOA2) ELISA Kit

abx575967-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

abx576098-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

APOA2 sgRNA CRISPR Lentivector set (Human)

K0104901 3 x 1.0 ug
EUR 339

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Apolipoprotein A2 (ApoA2) CLIA Kit

abx195157-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Apolipoprotein A2 (APOA2) ELISA Kit

abx357020-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

abx256663-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Apolipoprotein A2 (APOA2) ELISA Kit

abx253598-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Apolipoprotein A2 (ApoA2) CLIA Kit

abx196719-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Apoa2 sgRNA CRISPR Lentivector set (Mouse)

K3647401 3 x 1.0 ug
EUR 339

Apolipoprotein A-II / APOA2, Human Recombinant

EUR 164

Apolipoprotein A-II / APOA2, Human Recombinant

EUR 479

Apoa2 sgRNA CRISPR Lentivector set (Rat)

K6925601 3 x 1.0 ug
EUR 339

Human Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
  • Apolipoprotein A-II
  • ProapoA-II
  • Truncated apolipoprotein A-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
  • Apolipoprotein A-II
  • ProapoA-II
  • Truncated apolipoprotein A-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Po-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Po-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Po-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Po-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Pig Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
  • Apolipoprotein A-II
  • ProapoA-II
  • Truncated apolipoprotein A-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Pig Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

SEA604Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
  • Apolipoprotein A-II
  • ProapoA-II
  • Truncated apolipoprotein A-II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Apolipoprotein A2 ELISA Kit (APOA2)

RK00915 96 Tests
EUR 521

Mouse Apolipoprotein A2 ELISA Kit (APOA2)

RK02605 96 Tests
EUR 521

Rat Apolipoprotein A2(APOA2)ELISA kit

QY-E10396 96T
EUR 361

Simian Apolipoprotein A2 (APOA2)ELISA Kit

QY-E110066 96T
EUR 439

Mouse Apolipoprotein A2(APOA2)ELISA kit

QY-E20145 96T
EUR 361

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

APOA2 Rabbit Polyclonal Antibody