APOA2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
APOA2 Polyclonal Antibody |
ABP57790-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein |
APOA2 Polyclonal Antibody |
ABP57790-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein |
APOA2 Polyclonal Antibody |
ABP57790-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human APOA2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of APOA2 from Human, Mouse, Rat. This APOA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOA2 protein |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
DLR-APOA2-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
RD-APOA2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
RDR-APOA2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
APOA2 Rabbit pAb |
A1711-100ul |
Abclonal |
100 ul |
EUR 308 |
APOA2 Rabbit pAb |
A1711-200ul |
Abclonal |
200 ul |
EUR 459 |
APOA2 Rabbit pAb |
A1711-20ul |
Abclonal |
20 ul |
Ask for price |
APOA2 Rabbit pAb |
A1711-50ul |
Abclonal |
50 ul |
Ask for price |
APOA2 Rabbit pAb |
A14690-100ul |
Abclonal |
100 ul |
EUR 308 |
APOA2 Rabbit pAb |
A14690-200ul |
Abclonal |
200 ul |
EUR 459 |
APOA2 Rabbit pAb |
A14690-20ul |
Abclonal |
20 ul |
EUR 183 |
APOA2 Rabbit pAb |
A14690-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit APOA2 ELISA Kit |
ERTA0517 |
Abclonal |
96Tests |
EUR 521 |
APOA2 Antibody |
45172-100ul |
SAB |
100ul |
EUR 252 |
APOA2 Antibody |
45172-50ul |
SAB |
50ul |
EUR 187 |
APOA2 Antibody |
DF7905 |
Affbiotech |
200ul |
EUR 304 |
Description: APOA2 Antibody detects endogenous levels of total APOA2. |
APOA2 Antibody |
1-CSB-PA001915GA01HU |
Cusabio |
|
|
- Form: liquid
- Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity purified
|
Description: A polyclonal antibody against APOA2. Recognizes APOA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal APOA2 / Apolipoprotein A II Antibody |
APG01944G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications: |
Polyclonal APOA2 / Apolipoprotein A II Antibody |
APG01945G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications: |
Polyclonal APOA2 / Apolipoprotein A II Antibody |
APG01946G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications: |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human) |
4-PAA604Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2) |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig) |
4-PAA604Po01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2) |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat) |
4-PAA604Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2) |
APOA2 Conjugated Antibody |
C45172 |
SAB |
100ul |
EUR 397 |
Anti-APOA2 antibody |
STJ111107 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia. |
Anti-APOA2 antibody |
STJ192001 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to APOA2 |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC |
4-PAA604Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Biotinylated |
4-PAA604Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Cy3 |
4-PAA604Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), FITC |
4-PAA604Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with FITC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), HRP |
4-PAA604Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with HRP. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), PE |
4-PAA604Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with PE. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC |
4-PAA604Po01-APC |
Cloud-Clone |
-
EUR 363.00
-
EUR 3527.00
-
EUR 975.00
-
EUR 465.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Biotinylated |
4-PAA604Po01-Biotin |
Cloud-Clone |
-
EUR 324.00
-
EUR 2644.00
-
EUR 773.00
-
EUR 399.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Cy3 |
4-PAA604Po01-Cy3 |
Cloud-Clone |
-
EUR 443.00
-
EUR 4661.00
-
EUR 1259.00
-
EUR 578.00
-
EUR 260.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), FITC |
4-PAA604Po01-FITC |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with FITC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), HRP |
4-PAA604Po01-HRP |
Cloud-Clone |
-
EUR 331.00
-
EUR 3073.00
-
EUR 862.00
-
EUR 419.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with HRP. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), PE |
4-PAA604Po01-PE |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with PE. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC |
4-PAA604Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Biotinylated |
4-PAA604Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Cy3 |
4-PAA604Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), FITC |
4-PAA604Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with FITC. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), HRP |
4-PAA604Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with HRP. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), PE |
4-PAA604Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with PE. |
Rabbit Apolipoprotein A2 (APOA2) ELISA Kit |
abx363450-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
APOA2 siRNA |
20-abx900371 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOA2 siRNA |
20-abx907812 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOA2 siRNA |
20-abx907813 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOA2 Protein |
20-abx263100 |
Abbexa |
-
EUR 328.00
-
EUR 1247.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
ApoA2 protein |
30-1048 |
Fitzgerald |
100 ug |
EUR 382 |
Description: Purified native Human ApoA2 protein |
Apolipoprotein A2 (APOA2) Antibody |
20-abx171267 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx171268 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx171269 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx101702 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx101703 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx101704 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx175422 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx175423 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx175424 |
Abbexa |
|
|
|
Apolipoprotein A2 (APOA2) Antibody |
20-abx242863 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA604Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Gln100)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC-Cy7 |
4-PAA604Po01-APC-Cy7 |
Cloud-Clone |
-
EUR 607.00
-
EUR 6934.00
-
EUR 1831.00
-
EUR 810.00
-
EUR 333.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Ala19~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7. |
Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA604Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOA2 (Gln24~Lys102)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7. |
Apolipoprotein A-II (APOA2) Antibody |
20-abx123469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein A-II (APOA2) Antibody |
20-abx148240 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein A-II (APOA2) Antibody |
abx034964-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Apolipoprotein A-II (APOA2) Antibody |
abx034964-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Apolipoprotein A2 (APOA2) Antibody Pair |
20-abx370690 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Apolipoprotein A2 (APOA2) Antibody (FITC) |
20-abx271096 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1511.00
-
EUR 704.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein A2 (APOA2) Antibody (FITC) |
20-abx271118 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein A2 (APOA2) Antibody (Biotin) |
20-abx271361 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1400.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein A2 (APOA2) Antibody (Biotin) |
20-abx271384 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apolipoprotein A II (APOA2) Antibody |
abx230507-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
APOA2 Blocking Peptide |
DF7905-BP |
Affbiotech |
1mg |
EUR 195 |
APOA2 cloning plasmid |
CSB-CL001915HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 303
- Sequence: atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggc
- Show more
|
Description: A cloning plasmid for the APOA2 gene. |
Rat APOA2 shRNA Plasmid |
20-abx985193 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human APOA2 ELISA Kit |
EHA0517 |
Abclonal |
96Tests |
EUR 521 |
Goat APOA2 ELISA Kit |
EGTA0517 |
Abclonal |
96Tests |
EUR 521 |
Canine APOA2 ELISA Kit |
ECA0517 |
Abclonal |
96Tests |
EUR 521 |
Chicken APOA2 ELISA Kit |
ECKA0517 |
Abclonal |
96Tests |
EUR 521 |
Bovine APOA2 ELISA Kit |
EBA0517 |
Abclonal |
96Tests |
EUR 521 |
Anserini APOA2 ELISA Kit |
EAA0517 |
Abclonal |
96Tests |
EUR 521 |
Rat APOA2 ELISA Kit |
ERA0517 |
Abclonal |
96Tests |
EUR 521 |
Sheep APOA2 ELISA Kit |
ESA0517 |
Abclonal |
96Tests |
EUR 521 |
Porcine APOA2 ELISA Kit |
EPA0517 |
Abclonal |
96Tests |
EUR 521 |
Mouse APOA2 ELISA Kit |
EMA0517 |
Abclonal |
96Tests |
EUR 521 |
Monkey APOA2 ELISA Kit |
EMKA0517 |
Abclonal |
96Tests |
EUR 521 |
Human APOA2 shRNA Plasmid |
20-abx950237 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse APOA2 shRNA Plasmid |
20-abx969190 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Apolipoprotein A2 (APOA2) |
4-RPA604Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02652
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Human Apolipoprotein A2 expressed in: E.coli |
Recombinant Apolipoprotein A2 (APOA2) |
4-RPA604Po01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: F1S1A9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.1kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Pig Apolipoprotein A2 expressed in: E.coli |
Recombinant Apolipoprotein A2 (APOA2) |
4-RPA604Ra01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P04638
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.9kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Rat Apolipoprotein A2 expressed in: E.coli |
APOA2 Recombinant Protein (Human) |
RP001552 |
ABM |
100 ug |
Ask for price |
APOA2 Recombinant Protein (Rat) |
RP190532 |
ABM |
100 ug |
Ask for price |
APOA2 Recombinant Protein (Mouse) |
RP116420 |
ABM |
100 ug |
Ask for price |
Mouse Apolipoprotein A2 (APOA2) Protein |
20-abx652542 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Apolipoprotein A2 (APOA2) Protein |
20-abx652543 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Guinea Pig APOA2 ELISA Kit |
EGA0517 |
Abclonal |
96Tests |
EUR 521 |
Human Apolipoprotein A2 (APOA2) Protein |
20-abx065403 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Pig Apolipoprotein A2 (APOA2) Protein |
20-abx065404 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Rat Apolipoprotein A2 (APOA2) Protein |
20-abx065405 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
APOA2 ORF Vector (Human) (pORF) |
ORF000518 |
ABM |
1.0 ug DNA |
EUR 95 |
APOA2 Apolipoprotein A-II Human |
PROTP02647-1 |
BosterBio |
Regular: 100ug |
EUR 317 |
Description: APOA2 Human isolated from Human HDL is a single, glycosylated, polypeptide chain having a molecular mass of 17.38kDa. APOA2 is purified using delipidation and gel permeation chromatographic technique. |
Apoa2 ORF Vector (Mouse) (pORF) |
ORF038808 |
ABM |
1.0 ug DNA |
EUR 506 |
Apoa2 ORF Vector (Rat) (pORF) |
ORF063512 |
ABM |
1.0 ug DNA |
EUR 506 |
APOA2 ELISA Kit (Human) (OKAN04533) |
OKAN04533 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.69 ng/mL |
APOA2 ELISA Kit (Mouse) (OKAN06281) |
OKAN06281 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL |
APOA2 ELISA Kit (Pig) (OKCD04399) |
OKCD04399 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.8 ug/mL |
APOA2 ELISA Kit (Human) (OKCD06573) |
OKCD06573 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.69ng/mL |
APOA2 ELISA Kit (Rat) (OKCD06574) |
OKCD06574 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: may play a role in lipid metabolism and transport.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.57ng/mL |
APOA2 ELISA Kit (Mouse) (OKCD02376) |
OKCD02376 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids, and affect the HDL metabolism. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.076 ng/mL |
APOA2 ELISA Kit (Mouse) (OKCA02159) |
OKCA02159 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids, and affect the HDL metabolism. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL |
APOA2 ELISA Kit (Human) (OKEH01868) |
OKEH01868 |
Aviva Systems Biology |
96 Wells |
EUR 544 |
Description: Description of target: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.151 ng/mL |
APOA2 ELISA Kit (Rat) (OKEH01869) |
OKEH01869 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May stabilize HDL (high density lipoprotein) structure by its association with lipids and affect the HDL metabolism.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.00402 ug/mL |
APOA2 ELISA Kit (Dog) (OKEH08707) |
OKEH08707 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
APOA2 ELISA Kit (Pig) (OKWB00316) |
OKWB00316 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 2.8 ng/mL |
Cow Apolipoprotein A2 (APOA2) ELISA Kit |
abx520836-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Apolipoprotein A2 (APOA2) ELISA Kit |
abx520837-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
abx520839-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Monkey Apolipoprotein A2 (APOA2) ELISA Kit |
abx360157-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
abx575769-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
abx575871-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein A2 (APOA2) ELISA Kit |
abx575967-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
abx576098-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
APOA2 sgRNA CRISPR Lentivector set (Human) |
K0104901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
20-abx153658 |
Abbexa |
-
EUR 6971.00
-
EUR 3714.00
-
EUR 864.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
20-abx154886 |
Abbexa |
-
EUR 7645.00
-
EUR 4074.00
-
EUR 942.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
20-abx155215 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Apolipoprotein A2 (APOA2) ELISA Kit |
20-abx150706 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Apolipoprotein A2 (ApoA2) CLIA Kit |
abx195157-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Apolipoprotein A2 (APOA2) ELISA Kit |
abx357020-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
abx256663-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein A2 (APOA2) ELISA Kit |
abx253598-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein A2 (ApoA2) CLIA Kit |
abx196719-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Apoa2 sgRNA CRISPR Lentivector set (Mouse) |
K3647401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Apolipoprotein A-II / APOA2, Human Recombinant |
P1383-10 |
Biovision |
|
EUR 164 |
Apolipoprotein A-II / APOA2, Human Recombinant |
P1383-50 |
Biovision |
|
EUR 479 |
Apoa2 sgRNA CRISPR Lentivector set (Rat) |
K6925601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Human Apolipoprotein A2 (APOA2) ELISA Kit |
4-SEA604Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
- Apolipoprotein A-II
- ProapoA-II
- Truncated apolipoprotein A-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Mouse Apolipoprotein A2 (APOA2) ELISA Kit |
4-SEA604Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
- Apolipoprotein A-II
- ProapoA-II
- Truncated apolipoprotein A-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Po-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5098.02 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Po-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 507.48 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Po-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 682.12 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Po-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2769.54 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Pig Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Pig Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Pig Apolipoprotein A2 (APOA2) ELISA Kit |
4-SEA604Po |
Cloud-Clone |
-
EUR 5149.00
-
EUR 2720.00
-
EUR 683.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
- Apolipoprotein A-II
- ProapoA-II
- Truncated apolipoprotein A-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Pig Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
SEA604Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A2 (APOA2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A2 (APOA2) in serum, plasma and other biological fluids. |
Rat Apolipoprotein A2 (APOA2) ELISA Kit |
4-SEA604Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein A2 elisa. Alternative names of the recognized antigen: Apo-A2
- Apolipoprotein A-II
- ProapoA-II
- Truncated apolipoprotein A-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein A2 (APOA2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Apolipoprotein A2 ELISA Kit (APOA2) |
RK00915 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Apolipoprotein A2 ELISA Kit (APOA2) |
RK02605 |
Abclonal |
96 Tests |
EUR 521 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
APOA2 Rabbit Polyclonal Antibody