APOC2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
APOC2 Polyclonal Antibody |
ES10844-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against APOC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
APOC2 Polyclonal Antibody |
ES10844-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against APOC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids. |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
DLR-APOC2-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
RDR-APOC2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
RD-APOC2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
APOC2 Rabbit pAb |
A1772-100ul |
Abclonal |
100 ul |
EUR 308 |
APOC2 Rabbit pAb |
A1772-200ul |
Abclonal |
200 ul |
EUR 459 |
APOC2 Rabbit pAb |
A1772-20ul |
Abclonal |
20 ul |
EUR 183 |
APOC2 Rabbit pAb |
A1772-50ul |
Abclonal |
50 ul |
EUR 223 |
Rabbit APOC2 ELISA Kit |
ERTA0522 |
Abclonal |
96Tests |
EUR 521 |
ApoC2 antibody |
20C-CR9014GP |
Fitzgerald |
1 mg |
EUR 165 |
Description: Goat polyclonal ApoC2 antibody (IgG fraction) |
APOC2 antibody |
38294-100ul |
SAB |
100ul |
EUR 252 |
APOC2 Antibody |
DF6607 |
Affbiotech |
200ul |
EUR 304 |
Description: APOC2 Antibody detects endogenous levels of total APOC2. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse) |
4-PAB996Eq01 |
Cloud-Clone |
-
EUR 271.00
-
EUR 2892.00
-
EUR 712.00
-
EUR 344.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2) |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse) |
4-PAB996Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2) |
ApoC2 Antibody (Center) |
6718-100 |
Biovision |
|
EUR 316 |
APOC2 Conjugated Antibody |
C38294 |
SAB |
100ul |
EUR 397 |
Anti-APOC2 antibody |
STJ119761 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. |
Anti-APOC2 antibody |
STJ192002 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to APOC2 |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC |
4-PAB996Eq01-APC |
Cloud-Clone |
-
EUR 382.00
-
EUR 3797.00
-
EUR 1043.00
-
EUR 492.00
-
EUR 234.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Biotinylated |
4-PAB996Eq01-Biotin |
Cloud-Clone |
-
EUR 338.00
-
EUR 2842.00
-
EUR 823.00
-
EUR 419.00
-
EUR 230.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Cy3 |
4-PAB996Eq01-Cy3 |
Cloud-Clone |
-
EUR 468.00
-
EUR 5021.00
-
EUR 1349.00
-
EUR 614.00
-
EUR 271.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), FITC |
4-PAB996Eq01-FITC |
Cloud-Clone |
-
EUR 325.00
-
EUR 3057.00
-
EUR 854.00
-
EUR 413.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), HRP |
4-PAB996Eq01-HRP |
Cloud-Clone |
-
EUR 348.00
-
EUR 3307.00
-
EUR 920.00
-
EUR 443.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), PE |
4-PAB996Eq01-PE |
Cloud-Clone |
-
EUR 325.00
-
EUR 3057.00
-
EUR 854.00
-
EUR 413.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with PE. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig) |
4-PAB996Gu01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2) |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC |
4-PAB996Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB996Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Cy3 |
4-PAB996Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), FITC |
4-PAB996Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), HRP |
4-PAB996Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), PE |
4-PAB996Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with PE. |
Rabbit Apolipoprotein C2 (APOC2) ELISA Kit |
abx363339-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
ApoC2 protein |
30R-2678 |
Fitzgerald |
50 ug |
EUR 302 |
Description: Purified native Human ApoC2 protein |
ApoC2 protein |
30-1051 |
Fitzgerald |
100 ug |
EUR 1426 |
Description: Purified native Human ApoC2 protein |
APOC2 siRNA |
20-abx907836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
APOC2 siRNA |
20-abx907837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx009580 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx175434 |
Abbexa |
|
|
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx175435 |
Abbexa |
|
|
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx101715 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx104940 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx130650 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx171276 |
Abbexa |
|
|
|
Apolipoprotein C2 (APOC2) Antibody |
20-abx171277 |
Abbexa |
|
|
|
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC-Cy7 |
4-PAB996Eq01-APC-Cy7 |
Cloud-Clone |
-
EUR 644.00
-
EUR 7474.00
-
EUR 1966.00
-
EUR 864.00
-
EUR 349.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Thr23~Ser101)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC |
4-PAB996Gu01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Biotinylated |
4-PAB996Gu01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Cy3 |
4-PAB996Gu01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), FITC |
4-PAB996Gu01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with FITC. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), HRP |
4-PAB996Gu01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with HRP. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), PE |
4-PAB996Gu01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with PE. |
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB996Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Ile13~Glu97)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7. |
APOC2 Blocking Peptide |
DF6607-BP |
Affbiotech |
1mg |
EUR 195 |
APOC2 cloning plasmid |
CSB-CL001932HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 306
- Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccctcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta
- Show more
|
Description: A cloning plasmid for the APOC2 gene. |
APOC2 cloning plasmid |
CSB-CL001932HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 219
- Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccttcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta
- Show more
|
Description: A cloning plasmid for the APOC2 gene. |
Apolipoprotein C2 (APOC2) Antibody (Biotin) |
20-abx272948 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC-Cy7 |
4-PAB996Gu01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: APOC2 (Asp32~Gln100)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7. |
Human APOC2 ELISA Kit |
EHA0522 |
Abclonal |
96Tests |
EUR 521 |
Goat APOC2 ELISA Kit |
EGTA0522 |
Abclonal |
96Tests |
EUR 521 |
Canine APOC2 ELISA Kit |
ECA0522 |
Abclonal |
96Tests |
EUR 521 |
Chicken APOC2 ELISA Kit |
ECKA0522 |
Abclonal |
96Tests |
EUR 521 |
Anserini APOC2 ELISA Kit |
EAA0522 |
Abclonal |
96Tests |
EUR 521 |
Bovine APOC2 ELISA Kit |
EBA0522 |
Abclonal |
96Tests |
EUR 521 |
Mouse APOC2 shRNA Plasmid |
20-abx969195 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human APOC2 shRNA Plasmid |
20-abx950242 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse APOC2 ELISA Kit |
EMA0522 |
Abclonal |
96Tests |
EUR 521 |
Rat APOC2 ELISA Kit |
ERA0522 |
Abclonal |
96Tests |
EUR 521 |
Sheep APOC2 ELISA Kit |
ESA0522 |
Abclonal |
96Tests |
EUR 521 |
Monkey APOC2 ELISA Kit |
EMKA0522 |
Abclonal |
96Tests |
EUR 521 |
Porcine APOC2 ELISA Kit |
EPA0522 |
Abclonal |
96Tests |
EUR 521 |
Recombinant Apolipoprotein C2 (APOC2) |
4-RPB996Eq01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: F7A1W7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 12.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Horse Apolipoprotein C2 expressed in: E.coli |
Recombinant Apolipoprotein C2 (APOC2) |
4-RPB996Gu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P27916
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Guinea pig Apolipoprotein C2 expressed in: E.coli |
Recombinant Apolipoprotein C2 (APOC2) |
4-RPB996Mu01 |
Cloud-Clone |
-
EUR 449.44
-
EUR 223.00
-
EUR 1410.40
-
EUR 536.80
-
EUR 973.60
-
EUR 364.00
-
EUR 3376.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q05020
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 39.4kDa
- Isoelectric Point: 6
|
Description: Recombinant Mouse Apolipoprotein C2 expressed in: E.coli |
APOC2 Recombinant Protein (Human) |
RP001582 |
ABM |
100 ug |
Ask for price |
APOC2 Recombinant Protein (Human) |
RP001585 |
ABM |
100 ug |
Ask for price |
APOC2 Recombinant Protein (Mouse) |
RP116459 |
ABM |
100 ug |
Ask for price |
APOC2 Recombinant Protein (Rat) |
RP190565 |
ABM |
100 ug |
Ask for price |
Human Apolipoprotein C-II (APOC2) |
1-CSB-EP001932HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 24.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Apolipoprotein C-II(APOC2) expressed in E.coli |
Human Apolipoprotein C-II (APOC2) |
1-CSB-YP001932HU |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 10.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Apolipoprotein C-II(APOC2) expressed in Yeast |
Horse Apolipoprotein C2 (APOC2) Protein |
20-abx166394 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Apolipoprotein C2 (APOC2) Protein |
20-abx065420 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1901.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Guinea Pig APOC2 ELISA Kit |
EGA0522 |
Abclonal |
96Tests |
EUR 521 |
Rat Apolipoprotein C2 (APOC2) Protein |
20-abx652550 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Apolipoprotein C2 (APOC2) Protein |
20-abx652551 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Apoc2 ORF Vector (Rat) (pORF) |
ORF063523 |
ABM |
1.0 ug DNA |
EUR 506 |
APOC2 ORF Vector (Human) (pORF) |
ORF000528 |
ABM |
1.0 ug DNA |
EUR 95 |
APOC2 ORF Vector (Human) (pORF) |
ORF000529 |
ABM |
1.0 ug DNA |
EUR 95 |
Apoc2 ORF Vector (Mouse) (pORF) |
ORF038821 |
ABM |
1.0 ug DNA |
EUR 506 |
APOC2 ELISA Kit (Human) (OKAN04534) |
OKAN04534 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.74 ng/mL |
APOC2 ELISA Kit (Mouse) (OKCA02336) |
OKCA02336 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition Immunoassay;Sensitivity: 9.4 ng/mL |
APOC2 ELISA Kit (Rat) (OKCD04474) |
OKCD04474 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: cofactor and activator of lipoprotein lipase; crucial for the hydrolysis of triacylglycerols and very-low-density lipoproteins; mRNA found mainly in the liver [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.137 ng/mL |
APOC2 ELISA Kit (Human) (OKCD07888) |
OKCD07888 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.74ng/mL |
APOC2 ELISA Kit (Rat) (OKCD09559) |
OKCD09559 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: cofactor and activator of lipoprotein lipase; crucial for the hydrolysis of triacylglycerols and very-low-density lipoproteins; mRNA found mainly in the liver.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.69ng/mL |
Apoc2 ELISA Kit (Mouse) (OKEH05270) |
OKEH05270 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
APOC2 ELISA Kit (Monkey) (OKEI00626) |
OKEI00626 |
Aviva Systems Biology |
96 Wells |
EUR 741 |
Description: Description of target: Component of chylomicrons, very low-density lipoproteins (VLDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL) in plasma. Plays an important role in lipoprotein metabolism as an activator of lipoprotein lipase. Both proapolipoprotein C-II and apolipoprotein C-II can activate lipoprotein lipase.;Species reactivity: Monkey;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.875 ng/mL |
Human Apolipoprotein C2 (ApoC2) CLIA Kit |
abx195165-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein C2 (APOC2) ELISA Kit |
20-abx150713 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
20-abx155220 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Guinea pig Apolipoprotein C2 (APOC2) Protein |
20-abx168809 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
20-abx258738 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Apolipoprotein C2 (APOC2) ELISA Kit |
abx253585-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Monkey Apolipoprotein C2 (APOC2) ELISA Kit |
abx353379-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Chicken Apolipoprotein C2 (APOC2) ELISA Kit |
abx356878-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein C2 (APOC2) ELISA Kit |
abx575242-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
abx575747-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Cow Apolipoprotein C2 (APOC2) ELISA Kit |
abx519076-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Apolipoprotein C2 (APOC2) ELISA Kit |
abx519077-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Apolipoprotein C2 (APOC2) ELISA Kit |
abx519079-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Apolipoprotein C2 (APOC2) CLIA Kit |
20-abx493349 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Apolipoprotein C2 (APOC2) CLIA Kit |
20-abx493350 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Apolipoprotein C2 (APOC2) CLIA Kit |
20-abx496329 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Apoc2 sgRNA CRISPR Lentivector set (Rat) |
K7436701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Apoc2 sgRNA CRISPR Lentivector set (Mouse) |
K4843401 |
ABM |
3 x 1.0 ug |
EUR 339 |
APOC2 sgRNA CRISPR Lentivector set (Human) |
K0106601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Apolipoprotein C2 ELISA Kit (APOC2) |
RK00922 |
Abclonal |
96 Tests |
EUR 521 |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein C2 (APOC2) in serum, plasma and other biological fluids. |
Human Apolipoprotein C2 (APOC2) ELISA Kit |
4-SEB996Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein C2 elisa. Alternative names of the recognized antigen: APC2
- Apo-C2
- ProapoC-II
- Apolipoprotein C-II
- Proapolipoprotein C-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
SEB996Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein C2 (APOC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein C2 (APOC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein C2 (APOC2) ELISA Kit |
4-SEB996Ra |
Cloud-Clone |
-
EUR 4926.00
-
EUR 2602.00
-
EUR 656.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein C2 elisa. Alternative names of the recognized antigen: APC2
- Apo-C2
- ProapoC-II
- Apolipoprotein C-II
- Proapolipoprotein C-II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein C2 ELISA Kit (APOC2) |
RK03507 |
Abclonal |
96 Tests |
EUR 521 |
ELISA kit for Human ApoC2 (Apolipoprotein C2) |
E-EL-H0466 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 377 |
- Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant |
CLIA kit for Human ApoC2 (Apolipoprotein C2) |
E-CL-H0379 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ApoC2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ApoC2 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Monkey ApoC2 (Apolipoprotein C2) |
E-EL-MK1665 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 520 |
- Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Monkey ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Monkey ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat ApoC2 (Apolipoprotein C2) |
E-EL-R1155 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ApoC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ApoC2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat ApoC2 (Apolipoprotein C2) in samples from Serum, Plasma, Cell supernatant |
Human APOC2/ Apolipoprotein C-II ELISA Kit |
E0180Hu |
Sunlong |
1 Kit |
EUR 537 |
Human APOC2(Apolipoprotein C-II) ELISA Kit |
EH0619 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 3.125-200 ng/ml
- Uniprot ID: P02655
- Alias: ApoC2(Apolipoprotein C2)/Apolipoprotein C-II/APC2/APOC2/Apo-CII/ApoC-II/apolipoprotein C-II/MGC75082
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml |
Bovine Apolipoprotein C- II, APOC2 ELISA KIT |
ELI-06416b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Apolipoprotein C- II, Apoc2 ELISA KIT |
ELI-06417m |
Lifescience Market |
96 Tests |
EUR 865 |
Canine Apolipoprotein C-II, APOC2 ELISA KIT |
ELI-06418d |
Lifescience Market |
96 Tests |
EUR 928 |
Human Apolipoprotein C- II, APOC2 ELISA KIT |
ELI-06419h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human APOC2 (Apolipoprotein C2) |
ELK2740 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Apolipoprotein C2 (APOC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Apolipop
- Show more
|
Description: A sandwich ELISA kit for detection of Apolipoprotein C2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Apolipoprotein C-II(APOC2) ELISA kit |
CSB-EL001932MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Mouse Apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Apolipoprotein C-II(APOC2) ELISA kit |
1-CSB-EL001932MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Mouse Apolipoprotein C-II(APOC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat apolipoprotein C-II (APOC2) ELISA kit |
CSB-EL001932RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Rat apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat apolipoprotein C-II (APOC2) ELISA kit |
1-CSB-EL001932RA |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Rat apolipoprotein C-II (APOC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Rat APOC2 (Apolipoprotein C2) |
ELK6533 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Apolipoprotein C2 (APOC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Apolipop
- Show more
|
Description: A sandwich ELISA kit for detection of Apolipoprotein C2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7436702 |
ABM |
1.0 ug DNA |
EUR 154 |
Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7436703 |
ABM |
1.0 ug DNA |
EUR 154 |
Apoc2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7436704 |
ABM |
1.0 ug DNA |
EUR 154 |
Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4843402 |
ABM |
1.0 ug DNA |
EUR 154 |
Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4843403 |
ABM |
1.0 ug DNA |
EUR 154 |
Apoc2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4843404 |
ABM |
1.0 ug DNA |
EUR 154 |
APOC2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0106602 |
ABM |
1.0 ug DNA |
EUR 154 |
APOC2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0106603 |
ABM |
1.0 ug DNA |
EUR 154 |
APOC2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0106604 |
ABM |
1.0 ug DNA |
EUR 154 |
APOC2 Protein Vector (Mouse) (pPB-C-His) |
PV155282 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Mouse) (pPB-N-His) |
PV155283 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Mouse) (pPM-C-HA) |
PV155284 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Mouse) (pPM-C-His) |
PV155285 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Rat) (pPB-C-His) |
PV254090 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Rat) (pPB-N-His) |
PV254091 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Rat) (pPM-C-HA) |
PV254092 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Rat) (pPM-C-His) |
PV254093 |
ABM |
500 ng |
EUR 603 |
APOC2 Protein Vector (Human) (pPB-His-MBP) |
PV322878 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-His-GST) |
PV322879 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-His-MBP) |
PV322882 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-His-GST) |
PV322883 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-C-His) |
PV002109 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-N-His) |
PV002110 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPM-C-HA) |
PV002111 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPM-C-His) |
PV002112 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-C-His) |
PV002113 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPB-N-His) |
PV002114 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPM-C-HA) |
PV002115 |
ABM |
500 ng |
EUR 329 |
APOC2 Protein Vector (Human) (pPM-C-His) |
PV002116 |
ABM |
500 ng |
EUR 329 |
Apoc2 3'UTR GFP Stable Cell Line |
TU151963 |
ABM |
1.0 ml |
Ask for price |
Apoc2 3'UTR Luciferase Stable Cell Line |
TU101963 |
ABM |
1.0 ml |
Ask for price |
Apoc2 3'UTR Luciferase Stable Cell Line |
TU200768 |
ABM |
1.0 ml |
Ask for price |
Apoc2 3'UTR GFP Stable Cell Line |
TU250768 |
ABM |
1.0 ml |
Ask for price |
APOC2 3'UTR GFP Stable Cell Line |
TU050971 |
ABM |
1.0 ml |
EUR 1394 |
APOC2 3'UTR Luciferase Stable Cell Line |
TU000971 |
ABM |
1.0 ml |
EUR 1394 |
APOC2 ELISA Kit (Human) : 96 Wells (OKEH01418) |
OKEH01418 |
Aviva Systems Biology |
96 Wells |
EUR 635 |
Description: Description of target: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
APOC2 Rabbit Polyclonal Antibody