APOD Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

APOD Polyclonal Antibody

ABP57794-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APOD protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOD from Human, Mouse, Rat. This APOD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOD protein

APOD Polyclonal Antibody

A50041 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human Apolipoprotein D (APOD) ELISA Kit

EUR 498
  • Should the Human Apolipoprotein D (APOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein D (APOD) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

EUR 647
  • Should the Human Apolipoprotein D (APOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein D (APOD) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

RD-APOD-Hu-48Tests 48 Tests
EUR 500

Human Apolipoprotein D (APOD) ELISA Kit

RD-APOD-Hu-96Tests 96 Tests
EUR 692

Human Apolipoprotein D (APOD) ELISA Kit

RDR-APOD-Hu-48Tests 48 Tests
EUR 522

Human Apolipoprotein D (APOD) ELISA Kit

RDR-APOD-Hu-96Tests 96 Tests
EUR 724

APOD Rabbit pAb

A5297-100ul 100 ul
EUR 308

APOD Rabbit pAb

A5297-200ul 200 ul
EUR 459

APOD Rabbit pAb

A5297-20ul 20 ul
EUR 183

APOD Rabbit pAb

A5297-50ul 50 ul
EUR 223

APOD Rabbit pAb

A15640-100ul 100 ul
EUR 308

APOD Rabbit pAb

A15640-200ul 200 ul
EUR 459

APOD Rabbit pAb

A15640-20ul 20 ul
EUR 183

APOD Rabbit pAb

A15640-50ul 50 ul
EUR 223

APOD Rabbit pAb

A16757-100ul 100 ul
EUR 308

APOD Rabbit pAb

A16757-200ul 200 ul
EUR 459

APOD Rabbit pAb

A16757-20ul 20 ul
EUR 183

APOD Rabbit pAb

A16757-50ul 50 ul
EUR 223

APOD Rabbit pAb

A16758-100ul 100 ul
EUR 308

APOD Rabbit pAb

A16758-200ul 200 ul
EUR 459

APOD Rabbit pAb

A16758-20ul 20 ul
EUR 183

APOD Rabbit pAb

A16758-50ul 50 ul
EUR 223


ERTA0525 96Tests
EUR 521

APOD Polyclonal Antibody, HRP Conjugated

A50042 100 µg
EUR 570.55
Description: fast delivery possible

APOD Polyclonal Antibody, FITC Conjugated

A50043 100 µg
EUR 570.55
Description: reagents widely cited

APOD Polyclonal Antibody, Biotin Conjugated

A50044 100 µg
EUR 570.55
Description: Ask the seller for details

APOD Antibody

ABD7987 100 ug
EUR 438

ApoD antibody

10R-A137b 100 ul
EUR 597
Description: Mouse monoclonal ApoD antibody

APOD Antibody

32751-100ul 100ul
EUR 252

ApoD antibody

70R-13930 100 ug
EUR 349
Description: Affinity purified Mouse polyclonal ApoD antibody

APOD antibody

70R-15776 50 ul
EUR 435
Description: Rabbit polyclonal APOD antibody

APOD Antibody

DF7987 200ul
EUR 304
Description: APOD Antibody detects endogenous levels of total APOD.

APOD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

APOD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD)

Rabbit Apolipoprotein D (APOD) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

APOD Conjugated Antibody

C32751 100ul
EUR 397

anti- APOD antibody

FNab00499 100µg
EUR 505.25
  • Immunogen: apolipoprotein D
  • Uniprot ID: P05090
  • Gene ID: 347
  • Research Area: Cancer, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against APOD

anti- APOD antibody

FNab00500 100µg
EUR 505.25
  • Recommended dilution: WB: 1:5000-1:50000
  • IF: 1:50-1:500
  • Immunogen: apolipoprotein D
  • Uniprot ID: P05090
  • Gene ID: 347
  • Research Area: Cancer, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against APOD

ApoD Antibody (NT)

EUR 316

Anti-APOD antibody

PAab00499 100 ug
EUR 355

Anti-APOD antibody

STJ73056 100 µg
EUR 359

Anti-APOD antibody

STJ27250 100 µl
EUR 277
Description: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism.

Anti-APOD antibody

STJ119174 100 µl
EUR 277

Anti-APOD antibody

STJ119175 100 µl
EUR 277

Anti-APOD antibody

STJ118101 100 µl
EUR 277

Anti-APOD antibody

STJ192003 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APOD

Apod/ Rat Apod ELISA Kit

ELI-06962r 96 Tests
EUR 886

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD)

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with APC.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with Biotin.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with Cy3.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with FITC.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with HRP.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with PE.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD)

Rabbit Apolipoprotein D(APOD) ELISA kit

E04A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apolipoprotein D(APOD) ELISA kit

E04A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apolipoprotein D(APOD) ELISA kit

E04A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apolipoprotein D, APOD ELISA KIT

ELI-06961Ra 96 Tests
EUR 928

Rabbit ApoD(Apolipoprotein D) ELISA Kit

ERB0013 96T
EUR 567.6
  • Detection range: 3.906-250 ng/ml
  • Uniprot ID: P37153
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 2.344 ng/ml

Rabbit Apolipoprotein D (APOD) ELISA Kit

abx256978-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ApoD protein

30R-2563 10 ug
EUR 458
Description: Purified recombinant Human ApoD protein

Apolipoprotein D (APOD) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein D (APOD) Antibody

abx148249-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein D (APOD) Antibody

abx033389-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

abx033389-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

abx432345-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Apolipoprotein D (APOD) Antibody

abx432346-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Apolipoprotein D (APOD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody

abx230499-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Apolipoprotein D (APOD) Antibody

abx230500-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

APOD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

APOD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

APOD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOD. Recognizes APOD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-human apoD antibody

STJ15100156 250 µg
EUR 336
Description: This monoclonal antibody enables sensitive and specific detection of human apoD in immunoassays such as ELISA

Anti-human apoD antibody

STJ15100157 250 µg
EUR 367
Description: This monoclonal antibody enables sensitive and specific detection of human apoD in immunoassays such as ELISA

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with APC.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with Biotin.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with Cy3.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with FITC.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with HRP.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with PE.

Apolipoprotein D (APOD) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Met1~Leu189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), APC

  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with APC.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with Biotin.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with Cy3.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), FITC

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with FITC.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), HRP

  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with HRP.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), PE

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with PE.

APOD Blocking Peptide

DF7987-BP 1mg
EUR 195

APOD cloning plasmid

CSB-CL001935HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atggtgatgctgctgctgctgctttccgcactggctggcctcttcggtgcggcagagggacaagcatttcatcttgggaagtgccccaatcctccggtgcaggagaattttgacgtgaataagtatctcggaagatggtacgaaattgagaagatcccaacaacctttgagaatgg
  • Show more
Description: A cloning plasmid for the APOD gene.

Apolipoprotein D (APOD) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Apolipoprotein D (APOD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein D (APOD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Apolipoprotein D/APOD Antibody

PA1388 100ug/vial
EUR 294

Anti-APOD (aa70-80) antibody

STJ73057 100 µg
EUR 359

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Ser189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7.

Apolipoprotein D (APOD) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOD (Gln21~Leu189)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Apolipoprotein D (APOD). This antibody is labeled with APC-Cy7.

ApoD ELISA Kit| Rabbit Apolipoprotein D ELISA Kit

EF016773 96 Tests
EUR 689

Rat APOD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHA0525 96Tests
EUR 521


ELA-E2168h 96 Tests
EUR 824


EGTA0525 96Tests
EUR 521


ECA0525 96Tests
EUR 521

Chicken APOD ELISA Kit

ECKA0525 96Tests
EUR 521


EBA0525 96Tests
EUR 521

Anserini APOD ELISA Kit

EAA0525 96Tests
EUR 521


EF006210 96 Tests
EUR 689


ERA0525 96Tests
EUR 521


ESA0525 96Tests
EUR 521

Porcine APOD ELISA Kit

EPA0525 96Tests
EUR 521


EMA0525 96Tests
EUR 521


EMKA0525 96Tests
EUR 521

Human APOD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse APOD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

APOD Recombinant Protein (Human)

RP001591 100 ug Ask for price

Recombinant Apolipoprotein D (APOD)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P05090
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Apolipoprotein D expressed in: E.coli

Recombinant Apolipoprotein D (APOD)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51910
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.5kDa
  • Isoelectric Point: 5.8
Description: Recombinant Mouse Apolipoprotein D expressed in: E.coli

Recombinant Apolipoprotein D (APOD)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23593
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Apolipoprotein D expressed in: E.coli

APOD Recombinant Protein (Rat)

RP190574 100 ug Ask for price

APOD Recombinant Protein (Mouse)

RP116468 100 ug Ask for price

Guinea Pig APOD ELISA Kit

EGA0525 96Tests
EUR 521

Human Apolipoprotein D (APOD) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Apolipoprotein D (APOD) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Apolipoprotein D (APOD) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

APOD ORF Vector (Human) (pORF)

ORF000531 1.0 ug DNA
EUR 95

Apod ORF Vector (Mouse) (pORF)

ORF038824 1.0 ug DNA
EUR 506

Apod ORF Vector (Rat) (pORF)

ORF063526 1.0 ug DNA
EUR 506

pECMV-Apod-m-FLAG Plasmid

PVT15119 2 ug
EUR 325

APOD ELISA Kit (Human) (OKAN05227)

OKAN05227 96 Wells
EUR 792
Description: Description of target: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.67 ng/mL

APOD ELISA Kit (Human) (OKCD07852)

OKCD07852 96 Wells
EUR 936
Description: Description of target: Recombinant Human Apoliprotein-D;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.67ng/mL

APOD ELISA Kit (Mouse) (OKCA02337)

OKCA02337 96 Wells
EUR 846
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.27 ng/mL

APOD ELISA Kit (Human) (OKEH04791)

OKEH04791 96 Wells
EUR 662
Description: Description of target: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 ng/mL

APOD ELISA Kit (Mouse) (OKEH05228)

OKEH05228 96 Wells
EUR 662
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.3 pg/mL

APOD ELISA Kit (Rat) (OKEH06044)

OKEH06044 96 Wells
EUR 662
Description: Description of target: APOD occurs in the macromolecular complex with lecithin-transport and binding of bilin. Appears to be able to transport a variety of ligands in a number of different contexts. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.09 ng/mL

APOD ELISA Kit (Chicken) (OKEI00104)

OKEI00104 96 Wells
EUR 741
Description: Description of target: ;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Cow Apolipoprotein D (APOD) ELISA Kit

abx519620-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Apolipoprotein D (APOD) ELISA Kit

abx519622-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Apolipoprotein D (APOD) ELISA Kit

abx519623-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Apolipoprotein D (APOD) ELISA Kit

abx361482-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Apolipoprotein D (APOD) ELISA Kit

abx573860-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Apolipoprotein D(APOD) ELISA kit

E06A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Apolipoprotein D(APOD) ELISA kit

E06A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Apolipoprotein D(APOD) ELISA kit

E06A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein D(APOD) ELISA kit

E02A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein D(APOD) ELISA kit

E02A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein D(APOD) ELISA kit

E02A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apolipoprotein D(APOD) ELISA kit

E03A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apolipoprotein D(APOD) ELISA kit

E03A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apolipoprotein D(APOD) ELISA kit

E03A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein D(APOD) ELISA kit

E01A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein D(APOD) ELISA kit

E01A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein D(APOD) ELISA kit

E01A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apolipoprotein D(APOD) ELISA kit

E08A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apolipoprotein D(APOD) ELISA kit

E08A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apolipoprotein D(APOD) ELISA kit

E08A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apolipoprotein D(APOD) ELISA kit

E07A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apolipoprotein D(APOD) ELISA kit

E07A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apolipoprotein D(APOD) ELISA kit

E07A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apolipoprotein D(APOD) ELISA kit

E09A0518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apolipoprotein D(APOD) ELISA kit

E09A0518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apolipoprotein D(APOD) ELISA kit

E09A0518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Apolipoprotein D(APOD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human APOD(Apolipoprotein D) ELISA Kit

EH2135 96T
EUR 476.25
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P05090
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Mouse Apolipoprotein D, Apod ELISA KIT

ELI-06959m 96 Tests
EUR 865

Bovine Apolipoprotein D, APOD ELISA KIT

ELI-06960b 96 Tests
EUR 928

Human Apolipoprotein D, APOD ELISA KIT

ELI-06963h 96 Tests
EUR 824

APOD sgRNA CRISPR Lentivector set (Human)

K0106901 3 x 1.0 ug
EUR 339

Human Apolipoprotein D (APOD) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Apolipoprotein D (ApoD) CLIA Kit

abx195167-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Apolipoprotein D (APOD) ELISA Kit

abx351120-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Monkey Apolipoprotein D (APOD) ELISA Kit

abx359528-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Apolipoprotein D (APOD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Apolipoprotein D (APOD) ELISA Kit

abx251470-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Apod sgRNA CRISPR Lentivector set (Mouse)

K4337001 3 x 1.0 ug
EUR 339

Human Apolipoprotein D(APOD) ELISA kit

CSB-EL001935HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein D (APOD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Apolipoprotein D(APOD) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein D(APOD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Apolipoprotein D(APOD) ELISA kit

CSB-EL001935MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Apolipoprotein D (APOD) in samples from serum, plasma, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Apolipoprotein D(APOD) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Apolipoprotein D(APOD) in samples from serum, plasma, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human APOD/ Apolipoprotein D ELISA Kit

E0183Hu 1 Kit
EUR 571

Apod sgRNA CRISPR Lentivector set (Rat)

K6867901 3 x 1.0 ug
EUR 339

Human Apolipoprotrein D (ApoD) ELISA Kit

MET-5074 96 assays
EUR 722

Human Apolipoprotein D (APOD) ELISA Kit

SEB968Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

SEB968Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

SEB968Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

SEB968Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein D (APOD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein D (APOD) in serum, plasma and other biological fluids.

Human Apolipoprotein D (APOD) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein D elisa. Alternative names of the recognized antigen: Apo-D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein D (APOD) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Apolipoprotein D ELISA Kit (APOD)

RK00925 96 Tests
EUR 521

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

APOD Rabbit Polyclonal Antibody