APOH Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

APOH Polyclonal Antibody
ABP57795-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human APOH protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOH from Human, Mouse, Rat. This APOH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOH protein
APOH Polyclonal Antibody
ABP57795-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APOH protein
  • Applications tips:
Description: A polyclonal antibody for detection of APOH from Human, Mouse, Rat. This APOH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APOH protein
APOH Polyclonal Antibody
ES10846-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APOH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
APOH Polyclonal Antibody
ES10846-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APOH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Bovine Apolipoprotein H (APOH) ELISA Kit
DLR-APOH-b-48T 48T
EUR 547
  • Should the Bovine Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Bovine Apolipoprotein H (APOH) ELISA Kit
DLR-APOH-b-96T 96T
EUR 715
  • Should the Bovine Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
EUR 479
  • Should the Human Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
EUR 621
  • Should the Human Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
EUR 489
  • Should the Mouse Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein H (APOH) in samples from serum, plasma, saliva or other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
EUR 635
  • Should the Mouse Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein H (APOH) in samples from serum, plasma, saliva or other biological fluids.
Rat Apolipoprotein H (APOH) ELISA Kit
EUR 508
  • Should the Rat Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids.
Rat Apolipoprotein H (APOH) ELISA Kit
EUR 661
  • Should the Rat Apolipoprotein H (APOH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein H (APOH) in samples from serum, plasma or other biological fluids.
Bovine Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-b-48Tests 48 Tests
EUR 580
Bovine Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-b-96Tests 96 Tests
EUR 807
Human Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Hu-48Tests 48 Tests
EUR 500
Human Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Hu-96Tests 96 Tests
EUR 692
Mouse Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Mu-48Tests 48 Tests
EUR 511
Mouse Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Mu-96Tests 96 Tests
EUR 709
Rat Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Ra-48Tests 48 Tests
EUR 534
Rat Apolipoprotein H (APOH) ELISA Kit
RDR-APOH-Ra-96Tests 96 Tests
EUR 742
Bovine Apolipoprotein H (APOH) ELISA Kit
RD-APOH-b-48Tests 48 Tests
EUR 555
Bovine Apolipoprotein H (APOH) ELISA Kit
RD-APOH-b-96Tests 96 Tests
EUR 771
Human Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Hu-48Tests 48 Tests
EUR 478
Human Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Hu-96Tests 96 Tests
EUR 662
Mouse Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Mu-48Tests 48 Tests
EUR 489
Mouse Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Mu-96Tests 96 Tests
EUR 677
Rat Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Ra-48Tests 48 Tests
EUR 511
Rat Apolipoprotein H (APOH) ELISA Kit
RD-APOH-Ra-96Tests 96 Tests
EUR 709
APOH Rabbit pAb
A1220-100ul 100 ul
EUR 308
APOH Rabbit pAb
A1220-200ul 200 ul
EUR 459
APOH Rabbit pAb
A1220-20ul 20 ul
EUR 183
APOH Rabbit pAb
A1220-50ul 50 ul
EUR 223
ERTA0528 96Tests
EUR 521
ApoH antibody
20R-1405 5 mg
EUR 303
Description: Goat polyclonal ApoH antibody
ApoH antibody
70R-10595 500 ug
EUR 512
Description: Affinity purified goat polyclonal ApoH antibody
ApoH antibody
70R-3219 50 ug
EUR 467
Description: Rabbit polyclonal ApoH antibody
APOH antibody
70R-15778 50 ul
EUR 435
Description: Rabbit polyclonal APOH antibody
APOH Antibody
32237-100ul 100ul
EUR 252
APOH Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
APOH Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOH. Recognizes APOH from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
APOH Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50
APOH Antibody
DF6352 200ul
EUR 304
Description: APOH Antibody detects endogenous levels of total APOH.
APOH Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
ApoH antibody
70R-5421 50 ug
EUR 467
Description: Rabbit polyclonal ApoH antibody
APOH Antibody
ABD6352 100 ug
EUR 438
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine)
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH)
Apolipoprotein H (APOH) Polyclonal Antibody (Dog)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH)
Apolipoprotein H (APOH) Polyclonal Antibody (Human)
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH)
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse)
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH)
Apolipoprotein H (APOH) Polyclonal Antibody (Rat)
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH)
ApoH antibody (HRP)
60R-1043 200 ug
EUR 392
Description: Goat polyclonal ApoH antibody (HRP) conjugated
ApoH Antibody Pair
55R-1022 5 plates
EUR 719
Description: ApoH Matched Pair antibody Set for ELISA, B2GP1 ELISA kit, beta 2 glycoprotein ELISA kit, BG ELISA kit, Apolipoprotein H ELISA kit, Apo H ELISA kit, Apo-H ELISA kit, B2G1 ELISA kit
APOH Conjugated Antibody
C32237 100ul
EUR 397
Anti-APOH antibody
STJ22654 100 µl
EUR 277
Description: Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections.
Anti-APOH antibody
STJ73310 100 µg
EUR 359
Anti-APOH antibody
STJ192004 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APOH
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), Biotinylated
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with PE.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with PE.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), Biotinylated
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with PE.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with PE.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), Biotinylated
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with PE.
ApoH protein
30-AB23 1 mg
EUR 1321
Description: Purified native Human ApoH protein
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
APOH Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
APOH Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
APOH Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOH. Recognizes APOH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Apolipoprotein H (APOH) Antibody
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Apolipoprotein H (APOH) Antibody
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
Apolipoprotein H (APOH) Antibody
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Apolipoprotein H (APOH) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Apolipoprotein H (APOH) Antibody
abx230509-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Apolipoprotein H (APOH) Antibody
abx230510-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Anti-human apoH antibody
STJ15100149 250 µg
EUR 336
Description: This monoclonal antibody enables sensitive and specific detection of apoH in immunoassays such as ELISA.
Anti-human apoH antibody
STJ15100150 250 µg
EUR 367
Description: This monoclonal antibody enables sensitive and specific detection of apoH in immunoassays such as ELISA.
Apolipoprotein H (APOH) Polyclonal Antibody (Bovine), APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Apolipoprotein H (APOH) Polyclonal Antibody (Dog), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Apolipoprotein H (APOH) Polyclonal Antibody (Human), APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Thr22~Cys345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Apolipoprotein H (APOH) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Arg21~Cys345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Apolipoprotein H (APOH) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOH (Gly20~Cys297)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Apolipoprotein H (APOH) Antibody (Biotin)
  • EUR 481.00
  • EUR 244.00
  • EUR 1400.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Apolipoprotein H (APOH) Antibody (Biotin)
  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Apolipoprotein H (APOH) Antibody (Biotin)
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Apolipoprotein H (APOH) Antibody (FITC)
  • EUR 509.00
  • EUR 258.00
  • EUR 1511.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Apolipoprotein H (APOH) Antibody (FITC)
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Apolipoprotein H (APOH) Antibody (FITC)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Anti-APOH (aa145-157) antibody
STJ72692 100 µg
EUR 359
ApoH Blocking Peptide
33R-5558 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOH antibody, catalog no. 70R-5421
ApoH Blocking Peptide
33R-7270 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOH antibody, catalog no. 70R-3219
APOH Blocking Peptide
DF6352-BP 1mg
EUR 195
APOH cloning plasmid
CSB-CL001939HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: atgatttctccagtgctcatcttgttctcgagttttctctgccatgttgctattgcaggacggacctgtcccaagccagatgatttaccattttccacagtggtcccgttaaaaacattctatgagccaggagaagagattacgtattcctgcaagccgggctatgtgtcccgag
  • Show more
Description: A cloning plasmid for the APOH gene.
Beta-2-Glycoprotein 1 (APOH) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
abx122365-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
abx431884-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
abx432348-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine)
  • EUR 267.00
  • EUR 2826.00
  • EUR 697.00
  • EUR 338.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH)
ApoH protein (His tag)
80R-2610 50 ug
EUR 327
Description: Purified recombinant ApoH protein
ELA-E0310h 96 Tests
EUR 824
EHA0528 96Tests
EUR 521
EGTA0528 96Tests
EUR 521
ECA0528 96Tests
EUR 521
Chicken APOH ELISA Kit
ECKA0528 96Tests
EUR 521
Anserini APOH ELISA Kit
EAA0528 96Tests
EUR 521
EBA0528 96Tests
EUR 521
EF001272 96 Tests
EUR 689
Mouse APOH shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human APOH shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EMA0528 96Tests
EUR 521
ERA0528 96Tests
EUR 521
ESA0528 96Tests
EUR 521
EMKA0528 96Tests
EUR 521
Porcine APOH ELISA Kit
EPA0528 96Tests
EUR 521
Recombinant Apolipoprotein H (APOH)
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17690
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Apolipoprotein H expressed in: E.coli
Recombinant Apolipoprotein H (APOH)
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P33703
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Apolipoprotein H expressed in: E.coli
Recombinant Apolipoprotein H (APOH)
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02749
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Apolipoprotein H expressed in: E.coli
Recombinant Apolipoprotein H (APOH)
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q01339
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.1kDa
  • Isoelectric Point: 8.5
Description: Recombinant Mouse Apolipoprotein H expressed in: E.coli
Recombinant Apolipoprotein H (APOH)
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P26644
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.0kDa
  • Isoelectric Point: 8.7
Description: Recombinant Rat Apolipoprotein H expressed in: E.coli
APOH Recombinant Protein (Human)
RP001600 100 ug Ask for price
Recombinant Human ApoH Protein
RP01089 10 μg
EUR 190
APOH Recombinant Protein (Mouse)
RP116477 100 ug Ask for price
APOH Recombinant Protein (Rat)
RP190583 100 ug Ask for price
STJ150241 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ApoH in human serum, plasma and other biological fluids
STJ150423 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of APO-H in Mouse serum, plasma and other biological fluids
Rabbit Apolipoprotein H (Beta-2-Glycoprotein 1) (APOH) ELISA Kit
abx256254-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Apolipoprotein H (Beta-2-Glycoprotein 1) (APOH) ELISA Kit
abx362900-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Beta-2-Glycoprotein 1 (APOH) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), APC
  • EUR 376.00
  • EUR 3707.00
  • EUR 1020.00
  • EUR 483.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), Biotinylated
  • EUR 334.00
  • EUR 2776.00
  • EUR 806.00
  • EUR 412.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Biotin.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), Cy3
  • EUR 459.00
  • EUR 4901.00
  • EUR 1319.00
  • EUR 602.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with Cy3.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), FITC
  • EUR 320.00
  • EUR 2985.00
  • EUR 836.00
  • EUR 406.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with FITC.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), HRP
  • EUR 342.00
  • EUR 3229.00
  • EUR 901.00
  • EUR 435.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with HRP.
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), PE
  • EUR 320.00
  • EUR 2985.00
  • EUR 836.00
  • EUR 406.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with PE.
Dog Apolipoprotein H (APOH) Protein
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Apolipoprotein H (APOH) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cow Apolipoprotein H (APOH) Protein
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human Apolipoprotein H (APOH) Protein
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Apolipoprotein H (APOH) Protein
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human APOH PicoKine ELISA Kit
EK2026 96 wells
EUR 425
Description: For quantitative detection of human APOH in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse APOH PicoKine ELISA Kit
EK2027 96 wells
EUR 425
Description: For quantitative detection of mouse APOH in cell culture supernates, serum and plasma (heparin, EDTA).
Guinea Pig APOH ELISA Kit
EGA0528 96Tests
EUR 521
Apoh ORF Vector (Rat) (pORF)
ORF063529 1.0 ug DNA
EUR 506
APOH ORF Vector (Human) (pORF)
ORF000534 1.0 ug DNA
EUR 95
Apoh ORF Vector (Mouse) (pORF)
ORF038827 1.0 ug DNA
EUR 506
APOH Apoliporotein-H Bovine protein
PROTP17690 Regular: 50ug
EUR 317
Description: Bovine Apolipoprotein-H polypeptide is purified from fetal calf serum (FCS) by proprietary protein-chemical techniques, having an Mw of approximately 70kDa.
APOH ELISA Kit (Mouse) (OKAN06620)
OKAN06620 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.42 ng/mL
Apoh ELISA Kit (Mouse) (OKBB01395)
OKBB01395 96 Wells
EUR 505
Description: Description of target: Apolipoprotein H (Apo-H), previously known as β2-glycoprotein I and beta-2 glycoprotein I, is a 38 kDa multifunctional apolipoprotein that in humans is encoded by the APOH gene. This gene is mapped to 11 E1; 11 71.8 Cm. Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
APOH ELISA Kit (Human) (OKCD06239)
OKCD06239 96 Wells
EUR 753
Description: Description of target: Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antipho;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.141ng/mL
APOH ELISA Kit (Mouse) (OKCD06240)
OKCD06240 96 Wells
EUR 779
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1.42ng/mL
APOH ELISA Kit (Rat) (OKCD06241)
OKCD06241 96 Wells
EUR 818
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.73ng/mL
APOH ELISA Kit (Bovine) (OKEH07365)
OKEH07365 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.51ng/ml
APOH ELISA Kit (Dog) (OKEH07366)
OKEH07366 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.38ng/ml
APOH ELISA Kit (Rat) (OKEH04191)
OKEH04191 96 Wells
EUR 662
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.79 ng/mL
APOH ELISA Kit (Mouse) (OKEH04192)
OKEH04192 96 Wells
EUR 662
Description: Description of target: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.28 ng/mL
Apolipoprotein H (APOH) Monoclonal Antibody (Bovine), APC-Cy7
  • EUR 632.00
  • EUR 7294.00
  • EUR 1921.00
  • EUR 846.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg21~Cys345
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Bovine Apolipoprotein H (APOH). This antibody is labeled with APC-Cy7.
Human Apolipoprotein H (ApoH) CLIA Kit
abx196453-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Apolipoprotein H(APOH) ELISA kit
CSB-E08961h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein H (APOH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Apolipoprotein H(APOH) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apolipoprotein H(APOH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Apolipoprotein H (APOH) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Apolipoprotein H (APOH) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Apolipoprotein H (APOH) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Canine Apolipoprotein H(APOH)ELISA Kit
GA-E0031CN-48T 48T
EUR 402
Canine Apolipoprotein H(APOH)ELISA Kit
GA-E0031CN-96T 96T
EUR 684
Apoh sgRNA CRISPR Lentivector set (Rat)
K6740201 3 x 1.0 ug
EUR 339
Apoh sgRNA CRISPR Lentivector set (Mouse)
K3377501 3 x 1.0 ug
EUR 339
APOH sgRNA CRISPR Lentivector set (Human)
K0107301 3 x 1.0 ug
EUR 339
APOH Apolipoprotein-H Human Recombinant Protein
PROTP02749 Regular: 10ug
EUR 317
Description: APOH Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 349 amino acids (20-345 a.a.) and having a molecular mass of 38.6kDa.;APOH is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Apolipoprotein H (APOH) ELISA Kit
SEA310Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
SEA310Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
SEA310Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
SEA310Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Human Apolipoprotein H (APOH) ELISA Kit
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein H elisa. Alternative names of the recognized antigen: Apo-H
  • B2G1
  • BG
  • B2-GP1
  • B2GP1
  • Previously
  • Beta 2 Glycoprotein 1
  • APC inhibitor
  • Activated protein C-binding protein
  • Anticardiolipin cofactor
  • Beta(2)GPI
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Apolipoprotein H (APOH) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Apolipoprotein H (APOH) ELISA Kit
SEA310Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
SEA310Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
SEA310Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
SEA310Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Apolipoprotein H (APOH) in serum, plasma, saliva and other biological fluids.
Mouse Apolipoprotein H (APOH) ELISA Kit
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein H elisa. Alternative names of the recognized antigen: Apo-H
  • B2G1
  • BG
  • B2-GP1
  • B2GP1
  • Previously
  • Beta 2 Glycoprotein 1
  • APC inhibitor
  • Activated protein C-binding protein
  • Anticardiolipin cofactor
  • Beta(2)GPI
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Apolipoprotein H (APOH) in samples from Serum, plasma, saliva and other biological fluids. with no significant corss-reactivity with analogues from other species.
Rat Apolipoprotein H (APOH) ELISA Kit
SEA310Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Rat Apolipoprotein H (APOH) ELISA Kit
SEA310Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids.
Rat Apolipoprotein H (APOH) ELISA Kit
SEA310Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein H (APOH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein H (APOH) in serum, plasma and other biological fluids.

APOH Rabbit Polyclonal Antibody