BCL7C Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

BCL7C Polyclonal Antibody
ES10760-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BCL7C from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
BCL7C Polyclonal Antibody
ABP57895-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
ABP57895-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
ABP57895-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein
BCL7C Polyclonal Antibody
42666-100ul 100ul
EUR 333
Polyclonal BCL7C polyclonal antibody
APR00452G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCL7C polyclonal . This antibody is tested and proven to work in the following applications:
BCL7C Polyclonal Conjugated Antibody
C42666 100ul
EUR 397
BCL7C Antibody
ABD2587 100 ug
EUR 438
BCL7C antibody
70R-15981 50 ul
EUR 435
Description: Rabbit polyclonal BCL7C antibody
BCL7C Antibody
DF2587 200ul
EUR 304
Description: BCL7C antibody detects endogenous levels of total BCL7C.
BCL7C Antibody
1-CSB-PA002629GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
BCL7C Antibody
1-CSB-PA845147DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Anti-BCL7C antibody
STJ191918 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BCL7C
BCL7C siRNA
20-abx909000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BCL7C siRNA
20-abx909001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BCL7C Protein
20-abx262722
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
anti-BCL7C
YF-PA16209 50 ul
EUR 363
Description: Mouse polyclonal to BCL7C
BCL7C Blocking Peptide
DF2587-BP 1mg
EUR 195
BCL7C cloning plasmid
CSB-CL845147HU1-10ug 10ug
EUR 293
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.
BCL7C cloning plasmid
CSB-CL845147HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.
Anti-BCL7C (5F1)
YF-MA16761 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C
Anti-BCL7C (1A4)
YF-MA16762 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C
BCL Tumor Suppressor 7C (BCL7C) Antibody
20-abx111193
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse Bcl7c ELISA KIT
ELI-25376m 96 Tests
EUR 865
Human BCL7C ELISA KIT
ELI-49954h 96 Tests
EUR 824
Human BCL7C shRNA Plasmid
20-abx956140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BCL7C protein (His tag)
80R-3579 50 ug
EUR 424
Description: Purified recombinant BCL7C protein (His tag)
Mouse BCL7C shRNA Plasmid
20-abx969338
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BCL7C Recombinant Protein (Human)
RP002959 100 ug Ask for price
BCL7C Recombinant Protein (Human)
RP002962 100 ug Ask for price
BCL7C Recombinant Protein (Rat)
RP192053 100 ug Ask for price
BCL7C Recombinant Protein (Mouse)
RP119345 100 ug Ask for price
Monoclonal BCL7C Antibody (monoclonal) (M01), Clone: 5F1
AMM03284G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BCL7C (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F1. This antibody is applicable in WB, E
BCL7C ORF Vector (Human) (pORF)
ORF000987 1.0 ug DNA
EUR 95
BCL7C ORF Vector (Human) (pORF)
ORF000988 1.0 ug DNA
EUR 95
Bcl7c ORF Vector (Mouse) (pORF)
ORF039783 1.0 ug DNA
EUR 506
Bcl7c ORF Vector (Rat) (pORF)
ORF064019 1.0 ug DNA
EUR 506
BCL7C sgRNA CRISPR Lentivector set (Human)
K0176601 3 x 1.0 ug
EUR 339
Bcl7c sgRNA CRISPR Lentivector set (Mouse)
K3239201 3 x 1.0 ug
EUR 339
Bcl7c sgRNA CRISPR Lentivector set (Rat)
K6627601 3 x 1.0 ug
EUR 339
BCL7C sgRNA CRISPR Lentivector (Human) (Target 1)
K0176602 1.0 ug DNA
EUR 154
BCL7C sgRNA CRISPR Lentivector (Human) (Target 2)
K0176603 1.0 ug DNA
EUR 154
BCL7C sgRNA CRISPR Lentivector (Human) (Target 3)
K0176604 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3239202 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3239203 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3239204 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6627602 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6627603 1.0 ug DNA
EUR 154
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6627604 1.0 ug DNA
EUR 154
BCL7C Protein Vector (Human) (pPB-C-His)
PV003945 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-N-His)
PV003946 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-HA)
PV003947 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-His)
PV003948 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-C-His)
PV003949 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-N-His)
PV003950 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-HA)
PV003951 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPM-C-His)
PV003952 500 ng
EUR 329
Recombinant Human BCL7C Protein, His, E.coli-10ug
QP11147-10ug 10ug
EUR 201
Recombinant Human BCL7C Protein, His, E.coli-1mg
QP11147-1mg 1mg
EUR 5251
Recombinant Human BCL7C Protein, His, E.coli-2ug
QP11147-2ug 2ug
EUR 155
BCL7C Protein Vector (Human) (pPB-His-MBP)
PV326594 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-GST)
PV326595 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-MBP)
PV326598 500 ng
EUR 329
BCL7C Protein Vector (Human) (pPB-His-GST)
PV326599 500 ng
EUR 329
BCL7C Protein Vector (Rat) (pPB-C-His)
PV256074 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPB-N-His)
PV256075 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPM-C-HA)
PV256076 500 ng
EUR 603
BCL7C Protein Vector (Rat) (pPM-C-His)
PV256077 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPB-C-His)
PV159130 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPB-N-His)
PV159131 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPM-C-HA)
PV159132 500 ng
EUR 603
BCL7C Protein Vector (Mouse) (pPM-C-His)
PV159133 500 ng
EUR 603
Bcl7c 3'UTR Luciferase Stable Cell Line
TU201284 1.0 ml Ask for price
Bcl7c 3'UTR GFP Stable Cell Line
TU152696 1.0 ml Ask for price
BCL7C 3'UTR Luciferase Stable Cell Line
TU001707 1.0 ml
EUR 1394
Bcl7c 3'UTR Luciferase Stable Cell Line
TU102696 1.0 ml Ask for price
BCL7C 3'UTR GFP Stable Cell Line
TU051707 1.0 ml
EUR 1394
Bcl7c 3'UTR GFP Stable Cell Line
TU251284 1.0 ml Ask for price
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit
E04B0774-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
BCL7C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV707823 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV707827 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV707828 1.0 ug DNA
EUR 316
BCL7C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621379 1.0 ug DNA
EUR 514
BCL7C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621383 1.0 ug DNA
EUR 514
BCL7C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621384 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

BCL7C Rabbit Polyclonal Antibody