CCAR1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CCAR1 Polyclonal Antibody

ES10505-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCAR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCAR1 Polyclonal Antibody

ES10505-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCAR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Human Ccar1 Polyclonal Antibody

CPBT-66492RH 0.1 mg
EUR 944

CCAR1 Rabbit pAb

A13595-100ul 100 ul
EUR 308

CCAR1 Rabbit pAb

A13595-200ul 200 ul
EUR 459

CCAR1 Rabbit pAb

A13595-20ul 20 ul
EUR 183

CCAR1 Rabbit pAb

A13595-50ul 50 ul
EUR 223

CCAR1 Rabbit pAb

A6334-100ul 100 ul
EUR 308

CCAR1 Rabbit pAb

A6334-200ul 200 ul
EUR 459

CCAR1 Rabbit pAb

A6334-20ul 20 ul
EUR 183

CCAR1 Rabbit pAb

A6334-50ul 50 ul
EUR 223

CCAR1 Antibody

36417-100ul 100ul
EUR 252

CCAR1 antibody

38833-100ul 100ul
EUR 252

CCAR1 Antibody

1-CSB-PA138742
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CCAR1 Antibody

1-CSB-PA816898ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCAR1 Antibody

1-CSB-PA816898ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CCAR1 Antibody

DF2281 200ul
EUR 304
Description: CCAR1 antibody detects endogenous levels of total CCAR1.

CCAR1 Antibody

ABD2281 100 ug
EUR 438

Polyclonal Goat Anti-CCAR1 Antibody

AMM04927G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCAR1 . This antibody is tested and proven to work in the following applications:

CCAR1 Conjugated Antibody

C36417 100ul
EUR 397

Anti-CCAR1 antibody

STJ28256 100 µl
EUR 277

Anti-CCAR1 antibody

STJ115556 100 µl
EUR 277

Anti-CCAR1 Antibody

STJ500384 100 µg
EUR 476

Anti-CCAR1 antibody

STJ72101 100 µg
EUR 359

Anti-CCAR1 antibody

STJ191663 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCAR1

CCAR1 siRNA

20-abx910451
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCAR1 siRNA

20-abx910452
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-CCAR1 Antibody (Biotin)

STJ500385 100 µg
EUR 586

Anti-CCAR1 Antibody (FITC)

STJ500386 100 µg
EUR 586

CCAR1 Blocking Peptide

DF2281-BP 1mg
EUR 195

CCAR1 cloning plasmid

CSB-CL816898HU-10ug 10ug
EUR 1225
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3453
  • Sequence: atggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccag
  • Show more
Description: A cloning plasmid for the CCAR1 gene.

Human CCAR1 ELISA KIT

ELI-24046h 96 Tests
EUR 824

CCAR1 ELISA KIT|Human

EF004736 96 Tests
EUR 689

Mouse CCAR1 shRNA Plasmid

20-abx976183
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCAR1 shRNA Plasmid

20-abx960886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Ccar1 ELISA KIT

ELI-50214m 96 Tests
EUR 865

Ccar1 ORF Vector (Rat) (pORF)

ORF064449 1.0 ug DNA
EUR 506

CCAR1 ORF Vector (Human) (pORF)

ORF012586 1.0 ug DNA
EUR 354

Ccar1 ORF Vector (Mouse) (pORF)

ORF040496 1.0 ug DNA
EUR 506

CCAR1 sgRNA CRISPR Lentivector set (Human)

K0372301 3 x 1.0 ug
EUR 339

Ccar1 sgRNA CRISPR Lentivector set (Mouse)

K4825101 3 x 1.0 ug
EUR 339

Ccar1 sgRNA CRISPR Lentivector set (Rat)

K6317401 3 x 1.0 ug
EUR 339

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx004842
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) Antibody

20-abx212846
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

abx146298-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx321539
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx321564
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

abx431934-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx225077
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0372302 1.0 ug DNA
EUR 154

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0372303 1.0 ug DNA
EUR 154

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0372304 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4825102 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4825103 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4825104 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6317402 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6317403 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6317404 1.0 ug DNA
EUR 154

CCAR1 Protein Vector (Mouse) (pPB-C-His)

PV161982 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPB-N-His)

PV161983 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPM-C-HA)

PV161984 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPM-C-His)

PV161985 500 ng
EUR 1065

CCAR1 Protein Vector (Rat) (pPB-C-His)

PV257794 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPB-N-His)

PV257795 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPM-C-HA)

PV257796 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPM-C-His)

PV257797 500 ng
EUR 1191

CCAR1 Protein Vector (Human) (pPB-C-His)

PV050341 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPB-N-His)

PV050342 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPM-C-HA)

PV050343 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPM-C-His)

PV050344 500 ng
EUR 481

Ccar1 3'UTR GFP Stable Cell Line

TU153213 1.0 ml Ask for price

Ccar1 3'UTR Luciferase Stable Cell Line

TU103213 1.0 ml Ask for price

Ccar1 3'UTR Luciferase Stable Cell Line

TU201733 1.0 ml Ask for price

Ccar1 3'UTR GFP Stable Cell Line

TU251733 1.0 ml Ask for price

CCAR1 3'UTR GFP Stable Cell Line

TU053579 1.0 ml
EUR 1394

CCAR1 3'UTR Luciferase Stable Cell Line

TU003579 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CCAR1 Rabbit Polyclonal Antibody