CCAR1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CCAR1 Polyclonal Antibody |
ABP58004-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CCAR1 protein at amino acid sequence of 840-920
- Applications tips:
|
Description: A polyclonal antibody for detection of CCAR1 from Human, Mouse. This CCAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCAR1 protein at amino acid sequence of 840-920 |
CCAR1 Polyclonal Antibody |
ABP58004-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CCAR1 protein at amino acid sequence of 840-920
- Applications tips:
|
Description: A polyclonal antibody for detection of CCAR1 from Human, Mouse. This CCAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCAR1 protein at amino acid sequence of 840-920 |
CCAR1 Rabbit pAb |
A6334-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
A6334-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
A6334-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
A6334-50ul |
Abclonal |
50 ul |
EUR 223 |
CCAR1 Rabbit pAb |
A13595-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
A13595-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
A13595-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
A13595-50ul |
Abclonal |
50 ul |
EUR 223 |
CCAR1 Antibody |
36417-100ul |
SAB |
100ul |
EUR 252 |
CCAR1 antibody |
38833-100ul |
SAB |
100ul |
EUR 252 |
CCAR1 Antibody |
DF2281 |
Affbiotech |
200ul |
EUR 304 |
Description: CCAR1 antibody detects endogenous levels of total CCAR1. |
CCAR1 Antibody |
1-CSB-PA816898ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CCAR1 Antibody |
1-CSB-PA816898ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CCAR1 Antibody |
1-CSB-PA138742 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
Polyclonal Goat Anti-CCAR1 Antibody |
AMM04927G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCAR1 . This antibody is tested and proven to work in the following applications: |
CCAR1 Conjugated Antibody |
C36417 |
SAB |
100ul |
EUR 397 |
Anti-CCAR1 antibody |
STJ191663 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCAR1 |
CCAR1 siRNA |
20-abx910451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCAR1 siRNA |
20-abx910452 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCAR1 Blocking Peptide |
DF2281-BP |
Affbiotech |
1mg |
EUR 195 |
CCAR1 cloning plasmid |
CSB-CL816898HU-10ug |
Cusabio |
10ug |
EUR 1225 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3453
- Sequence: atggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccag
- Show more
|
Description: A cloning plasmid for the CCAR1 gene. |
Mouse CCAR1 shRNA Plasmid |
20-abx976183 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CCAR1 shRNA Plasmid |
20-abx960886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Ccar1 ORF Vector (Mouse) (pORF) |
ORF040496 |
ABM |
1.0 ug DNA |
EUR 506 |
CCAR1 ORF Vector (Human) (pORF) |
ORF012586 |
ABM |
1.0 ug DNA |
EUR 354 |
Ccar1 ORF Vector (Rat) (pORF) |
ORF064449 |
ABM |
1.0 ug DNA |
EUR 506 |
CCAR1 sgRNA CRISPR Lentivector set (Human) |
K0372301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ccar1 sgRNA CRISPR Lentivector set (Rat) |
K6317401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ccar1 sgRNA CRISPR Lentivector set (Mouse) |
K4825101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
E04C1426-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
E04C1426-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
E04C1426-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
abx146298-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
20-abx004842 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
20-abx321539 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
20-abx321564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
abx431934-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) Antibody |
20-abx212846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
20-abx225077 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
CCAR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0372302 |
ABM |
1.0 ug DNA |
EUR 154 |
CCAR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0372303 |
ABM |
1.0 ug DNA |
EUR 154 |
CCAR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0372304 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6317402 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6317403 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6317404 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4825102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4825103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4825104 |
ABM |
1.0 ug DNA |
EUR 154 |
CCAR1 Protein Vector (Human) (pPB-C-His) |
PV050341 |
ABM |
500 ng |
EUR 481 |
CCAR1 Protein Vector (Human) (pPB-N-His) |
PV050342 |
ABM |
500 ng |
EUR 481 |
CCAR1 Protein Vector (Human) (pPM-C-HA) |
PV050343 |
ABM |
500 ng |
EUR 481 |
CCAR1 Protein Vector (Human) (pPM-C-His) |
PV050344 |
ABM |
500 ng |
EUR 481 |
CCAR1 Protein Vector (Rat) (pPB-C-His) |
PV257794 |
ABM |
500 ng |
EUR 1191 |
CCAR1 Protein Vector (Rat) (pPB-N-His) |
PV257795 |
ABM |
500 ng |
EUR 1191 |
CCAR1 Protein Vector (Rat) (pPM-C-HA) |
PV257796 |
ABM |
500 ng |
EUR 1191 |
CCAR1 Protein Vector (Rat) (pPM-C-His) |
PV257797 |
ABM |
500 ng |
EUR 1191 |
CCAR1 Protein Vector (Mouse) (pPB-C-His) |
PV161982 |
ABM |
500 ng |
EUR 1065 |
CCAR1 Protein Vector (Mouse) (pPB-N-His) |
PV161983 |
ABM |
500 ng |
EUR 1065 |
CCAR1 Protein Vector (Mouse) (pPM-C-HA) |
PV161984 |
ABM |
500 ng |
EUR 1065 |
CCAR1 Protein Vector (Mouse) (pPM-C-His) |
PV161985 |
ABM |
500 ng |
EUR 1065 |
Ccar1 3'UTR Luciferase Stable Cell Line |
TU201733 |
ABM |
1.0 ml |
Ask for price |
Ccar1 3'UTR GFP Stable Cell Line |
TU153213 |
ABM |
1.0 ml |
Ask for price |
CCAR1 3'UTR Luciferase Stable Cell Line |
TU003579 |
ABM |
1.0 ml |
EUR 1394 |
Ccar1 3'UTR Luciferase Stable Cell Line |
TU103213 |
ABM |
1.0 ml |
Ask for price |
CCAR1 3'UTR GFP Stable Cell Line |
TU053579 |
ABM |
1.0 ml |
EUR 1394 |
Ccar1 3'UTR GFP Stable Cell Line |
TU251733 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CCAR1 Rabbit Polyclonal Antibody