CD5L Rabbit Polyclonal Antibody

Order Now:

CD5L Polyclonal Antibody
ABP58070-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of CD5L from Human, Mouse. This CD5L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
CD5L Polyclonal Antibody
ABP58070-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of CD5L from Human, Mouse. This CD5L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
CD5L Polyclonal Antibody
ES10519-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CD5L Polyclonal Antibody
ES10519-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Rabbit Anti Cd5l (C-Terminal) Polyclonal Antibody
CPBT-65327RC 0.1 mg
EUR 710
CD5L Rabbit pAb
A6223-100ul 100 ul
EUR 308
CD5L Rabbit pAb
A6223-200ul 200 ul
EUR 459
CD5L Rabbit pAb
A6223-20ul 20 ul
EUR 183
CD5L Rabbit pAb
A6223-50ul 50 ul
EUR 223
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-48T 48T
EUR 554
  • Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-96T 96T
EUR 725
  • Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-48T 48T
EUR 566
  • Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-96T 96T
EUR 741
  • Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-48Tests 48 Tests
EUR 589
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-96Tests 96 Tests
EUR 820
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-48Tests 48 Tests
EUR 603
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-96Tests 96 Tests
EUR 840
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-48Tests 48 Tests
EUR 563
Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-96Tests 96 Tests
EUR 783
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-48Tests 48 Tests
EUR 577
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-96Tests 96 Tests
EUR 802
Rabbit CD5L ELISA Kit
ERTC0038 96Tests
EUR 521
CD5L Antibody
37478-100ul 100ul
EUR 252
CD5L antibody
38759-100ul 100ul
EUR 252
CD5L Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000
CD5L Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
CD5L Antibody
DF2304 200ul
EUR 304
Description: CD5L antibody detects endogenous levels of total CD5L.
CD5L Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CD5L Antibody
ABD2304 100 ug
EUR 438
Polyclonal AIM / CD5L Antibody (N-Terminus)
APR02297G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIM / CD5L (N-Terminus). This antibody is tested and proven to work in the following applications:
Anti-CD5L antibody
STJ27979 100 µl
EUR 277
Anti-CD5L antibody
STJ191677 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CD5L
CD5l protein
80R-4353 50 ug
EUR 349
Description: Purified Recombinant CD5l protein (His tagged)
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA10755 50 ul
EUR 363
Description: Mouse polyclonal to CD5L
YF-PA10756 100 ug
EUR 403
Description: Rabbit polyclonal to CD5L
YF-PA27189 50 ug
EUR 363
Description: Mouse polyclonal to CD5L
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human)
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L)
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse)
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L)
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat)
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L)
CD5L Blocking Peptide
DF2304-BP 1mg
EUR 195
CD5L cloning plasmid
CSB-CL004948HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atggctctgctattctccttgatccttgccatttgcaccagacctggattcctagcgtctccatctggagtgcggctggtggggggcctccaccgctgtgaagggcgggtggaggtggaacagaaaggccagtggggcaccgtgtgtgatgacggctgggacattaaggacgtgg
  • Show more
Description: A cloning plasmid for the CD5L gene.
anti-CD5L (1C8)
LF-MA10050 100 ug
EUR 363
Description: Mouse monoclonal to CD5L
CD5 Molecule Like (CD5L) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
CD5 Molecule Like (CD5L) Antibody
abx031276-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
CD5 Molecule Like (CD5L) Antibody
abx031276-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CD5 Molecule Like (CD5L) Antibody
abx411856-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.
CD5 Molecule Like (CD5L) Antibody
abx411857-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.
CD5 Molecule Like (CD5L) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Biotinylated
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Biotinylated
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CD5 Antigen Like Protein (CD5L) Antibody
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human CD5L ELISA Kit
EHC0038 96Tests
EUR 521
Human CD5L ELISA Kit
ELA-E2547h 96 Tests
EUR 824
EGTC0038 96Tests
EUR 521
Bovine CD5L ELISA Kit
EBC0038 96Tests
EUR 521
Canine CD5L ELISA Kit
ECC0038 96Tests
EUR 521
Chicken CD5L ELISA Kit
ECKC0038 96Tests
EUR 521
Anserini CD5L ELISA Kit
EAC0038 96Tests
EUR 521
EF006297 96 Tests
EUR 689
Mouse CD5L shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CD5L shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CD5L ELISA Kit
EMC0038 96Tests
EUR 521
ERC0038 96Tests
EUR 521
Sheep CD5L ELISA Kit
ESC0038 96Tests
EUR 521
Monkey CD5L ELISA Kit
EMKC0038 96Tests
EUR 521
Porcine CD5L ELISA Kit
EPC0038 96Tests
EUR 521
pCMV-SPORT6-CD5L Plasmid
PVT16345 2 ug
EUR 325
CD5L Recombinant Protein (Human)
RP006394 100 ug Ask for price
CD5L Recombinant Protein (Rat)
RP194000 100 ug Ask for price
CD5L Recombinant Protein (Mouse)
RP122657 100 ug Ask for price
CD5 Antigen Like Protein (CD5L) Antibody (FITC)
  • EUR 523.00
  • EUR 258.00
  • EUR 1581.00
  • EUR 732.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
CD5 Antigen Like Protein (CD5L) Antibody (FITC)
  • EUR 537.00
  • EUR 272.00
  • EUR 1664.00
  • EUR 759.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Monoclonal CD5L Antibody (monoclonal) (M01), Clone: 1C8
AMM03348G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CD5L (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C8. This antibody is applicable in WB, IP, E
ELISA kit for Human CD5L
EK5657 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Mouse CD5L
EK5658 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.
Human CD5L PicoKine ELISA Kit
EK1413 96 wells
EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Mouse CD5L PicoKine ELISA Kit
EK1414 96 wells
EUR 425
Description: For quantitative detection of activated mouse CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Guinea Pig CD5L ELISA Kit
EGC0038 96Tests
EUR 521
Cd5l ORF Vector (Rat) (pORF)
ORF064668 1.0 ug DNA
EUR 506
CD5L ORF Vector (Human) (pORF)
ORF002132 1.0 ug DNA
EUR 95
Cd5l ORF Vector (Mouse) (pORF)
ORF040887 1.0 ug DNA
EUR 506
Recombinant Human CD5L/API6 Protein
RP00198 10 μg
EUR 155
CD5L ELISA Kit (Human) (OKCD02440)
OKCD02440 96 Wells
EUR 909
Description: Description of target: Secreted protein that acts as a key regulator of lipid synthesis: mainly expressed by macrophages in lymphoid and inflammed tissues and regulates mechanisms in inflammatory responses, such as infection or atherosclerosis. Able to inhibit lipid droplet size in adipocytes. Following incorporation into mature adipocytes via CD36-mediated endocytosis, associates with cytosolic FASN, inhibiting fatty acid synthase activity and leading to lipolysis, the degradation of triacylglycerols into glycerol and free fatty acids (FFA). CD5L-induced lipolysis occurs with progression of obesity: participates in obesity-associated inflammation following recruitment of inflammatory macrophages into adipose tissues, a cause of insulin resistance and obesity-related metabolic disease. Regulation of intracellular lipids mediated by CD5L has a direct effect on transcription regulation mediated by nuclear receptors ROR-gamma (RORC). Acts as a key regulator of metabolic switch in T-helper Th17 cells. Regulates the expression of pro-inflammatory genes in Th17 cells by altering the lipid content and limiting synthesis of cholesterol ligand of RORC, the master transcription factor of Th17-cell differentiation. CD5L is mainly present in non-pathogenic Th17 cells, where it decreases the content of polyunsaturated fatty acyls (PUFA), affecting two metabolic proteins MSMO1 and CYP51A1, which synthesize ligands of RORC, limiting RORC activity and expression of pro-inflammatory genes. Participates in obesity-associated autoimmunity via its association with IgM, interfering with the binding of IgM to Fcalpha/mu receptor and enhancing the development of long-lived plasma cells that produce high-affinity IgG autoantibodies. Also acts as an inhibitor of apoptosis in macrophages: promotes macrophage survival from the apoptotic effects of oxidized lipids in case of atherosclerosis. Involved in early response to microbial infection against various pathogens by acting as a pattern recognition receptor and by promoting autophagy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL
CD5L ELISA Kit (Human) (OKBB00971)
OKBB00971 96 Wells
EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
CD5L ELISA Kit (Mouse) (OKBB00972)
OKBB00972 96 Wells
EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
CD5L ELISA Kit (Human) (OKBB01545)
OKBB01545 96 Wells
EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
Cd5l ELISA Kit (Mouse) (OKBB01546)
OKBB01546 96 Wells
EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
CD5L ELISA Kit (Mouse) (OKCD09297)
OKCD09297 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.136ng/mL
CD5L ELISA Kit (Mouse) (OKEH01656)
OKEH01656 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL
CD5L sgRNA CRISPR Lentivector set (Human)
K0400201 3 x 1.0 ug
EUR 339
Cd5l sgRNA CRISPR Lentivector set (Rat)
K7473601 3 x 1.0 ug
EUR 339
Cd5l sgRNA CRISPR Lentivector set (Mouse)
K4335001 3 x 1.0 ug
EUR 339
Recombinant CD5 Antigen Like Protein (CD5L)
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43866
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human CD5 Antigen Like Protein expressed in: E.coli

CD5L Rabbit Polyclonal Antibody